Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD19

BD™ AbSeq Oligo Mouse Anti-Human CD19

Clone SJ25C1 (also known as SJ25-C1) (RUO)

556432
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
B4; B-lymphocyte antigen CD19; Leu-12
930
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGTAATGTGTTCGTAGCCGGTAATAATCTTCGTGG
AHS0030
Human NALM1 + NALM16 cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940004 Rev. 3
Antibody Details
Down Arrow
SJ25C1

The SJ25C1 monoclonal antibody specifically binds to CD19, a B lymphocyte-lineage differentiation antigen. CD19, a 90-kDa transmembrance glycoprotein, is a member of the immunoglobulin superfamily and is expressed throughout B-lymphocyte development from the pro-B cell through the mature B-cell stages. Terminally differentiated plasma cells do not express CD19. On the surface of mature B cells, the CD19 molecule associates with CD21 (CR-2) and CD81 (TAPA-1), and this multimolecular complex synergizes with surface immunoglobulin to promote cellular activation. Studies with CD19-deficient mice have suggested that the level of CD19 expression affects the generation and maturation of B cells in the bone marrow and periphery. B-1 lineage B cells, also known as CD5+ B cells, are drastically reduced or absent in CD19-deficient mice. Increased levels of CD19 expression correlate with increased frequencies of peritonal and splenic B-1 cells and reduced numbers of conventional B lymphocytes in the periphery. CD19 participates in B-lymphocyte development, B-cell activation, maturation of memory B cells and regulation of tolerance. CD19 has also been detected on peritoneal mast cells, co-localized with CD21/CD35, and it is proposed to play a role in complement-mediated mast-cell activation.

940004 Rev. 3
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940004 Rev.3
Citations & References
Down Arrow

Development References (5)

  1. Dörken B, Möller P, Pezzutto A, Schwartz-Albiez R, Moldenhauer G. B-cell antigens: CD19. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:34-36.
  2. Loken MR, Shah VO, Dattilio KL, Civin CI. Flow cytometric analysis of human bone marrow. II. Normal B lymphocyte development. Blood. 1987; 70(5):1316-1324. (Biology). View Reference
  3. Moldenhauer G, Dörken B, Schwartz R, Pezzutto A, Knops J, Hammerling GJ. Analysis of ten B lymphocyte-specific workshop monoclonal antibodies. In: Reinherz EL, Haynes BF, Nadler LM, Bernstein ID, ed. Leukocyte Typing II: Human B Lymphocytes. New York: Springer-Verlag; 1986:61-67.
  4. Nadler LM. B Cell/Leukemia Panel Workshop: summary and comments. In: Reinherz EL, Haynes BF, Nadler LM, Bernstein ID, ed. Leukocyte Typing II: Human B Lymphocytes. New York: Springer-Verlag; 1986:3-43.
  5. Tedder TF, Zhou LJ, Engel P. The CD19/CD21 signal transduction complex of B lymphocytes. Immunol Today. 1994; 15(9):437-442. (Biology). View Reference
940004 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.