Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse H-2Kd

BD™ AbSeq Oligo Mouse Anti-Mouse H-2Kd

Clone SF1-1.1 (RUO)

98-10004-00
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
H-2kd; H2kd; MHC class I H-2Kd
14972
2 µl
Mouse SJL IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTAGGTTGTCGAGTGTATTTAGGTTGAGTGCGCGT
AMM2090
BALB/c Mouse Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940194 Rev. 2
Antibody Details
Down Arrow
SF1-1.1

The SF1-1.1 antibody reacts with the α3 domain of the H-2K[d] MHC class I alloantigen. Reactivity with other haplotypes (e.g, b, j, k, p, q, s, v) has not been observed. It has been reported that plate-bound SF1-1.1 mAb moderately enhances the apoptotic response of thymocytes to plate-bound 145-2C11 mAb (anti-mouse CD3e).

940194 Rev. 2
Citations & References
Down Arrow

Development References (3)

  1. Abastado JP, Casrouge A, Kourilsky P. Differential role of conserved and polymorphic residues of the binding groove of MHC class I molecules in the selection of peptides. J Immunol. 1993; 151(7):3569-3575. (Clone-specific). View Reference
  2. Noun G, Reboul M, Abastado JP, Jaulin C, Kourilsky P, Pla M. Alloreactive monoclonal antibodies select Kd molecules with different peptide profiles. J Immunol. 1996; 157(6):2455-2461. (Clone-specific). View Reference
  3. Zhao Y, Iwata M. Cross-linking of the TCR-CD3 complex with CD4, CD8 or LFA-1 induces an anti-apoptotic signal in thymocytes: the signal is canceled by FK506. Int Immunol. 1995; 7(9):1387-1396. (Biology). View Reference
940194 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.