Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD11a

BD™ AbSeq Oligo Rat Anti-Mouse CD11a

Clone M17/4 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Itgal; Integrin alpha-L; Integrin αL; ITAL; LFA-1A; LFA-1α; Ly-15
16408
2 µl
Rat WF, also known as Wistar Furth IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGGGATTTAGTAGGTTTAGGATAGGTGATTCGTGG
AMM2147
C57BL/6 Mouse Splenic Secondary Cytotoxic T Lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940347 Rev. 2
Antibody Details
Down Arrow Up Arrow
M17/4

The M17/4 antibody reacts with the 180 kDa αL chain of LFA-1 (CD11a/CD18, αLβ2 integrin), a heterodimeric surface glycoprotein expressed on almost all leukocytes. CD8a+CD8b- intestinal intraepithelial T lymphocytes, which are believed to be thymus independent, do not express CD11a. LFA-1 mediates a variety of heterotypic and homotypic intercellular adhesions through interaction with ICAM-1 (CD54) and ICAM-2 (CD102), including participation in the immunological synapses between CD8+ T lymphocytes and antigen-presenting cells. mAb M17/4 blocks a variety of LFA-1-mediated cells interactions in vitro, and costimulatory effects have also been described. In vivo treatment with M17/4 mAb reduces the severity of graft-versus-host reactions, prolongs allograft survival, inhibits the development of autoimmunity, and blocks substance P-induced leukocyte migration. The M17/4 and 2D7 (Cat. No. 553120) antibodies are reported to recognize different epitopes of the CD11a molecule.

940347 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940347 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940347" on CiteAb

Development References (10)

  1. Driessens MH, van Hulten P, Zuurbier A, La Riviere G, Roos E. Inhibition and stimulation of LFA-1 and Mac-1 functions by antibodies against murine CD18. Evidence that the LFA-1 binding sites for ICAM-1, -2, and -3 are distinct. J Leukoc Biol. 1996; 60(6):758-765. (Clone-specific: Immunohistochemistry). View Reference
  2. Harning R, Pelletier J, Lubbe K, Takei F, Merluzzi VJ. Reduction in the severity of graft-versus-host disease and increased survival in allogenic mice by treatment with monoclonal antibodies to cell adhesion antigens LFA-1 alpha and MALA-2. Transplantation. 1991; 52(5):842-845. (Clone-specific: Immunohistochemistry). View Reference
  3. Kuhlman P, Moy VT, Lollo BA, Brian AA. The accessory function of murine intercellular adhesion molecule-1 in T lymphocyte activation. Contributions of adhesion and co-activation. J Immunol. 1991; 146(6):1773-1782. (Clone-specific: (Co)-stimulation). View Reference
  4. Larson RS, Springer TA. Structure and function of leukocyte integrins. Immunol Rev. 1990; 114:181-217. (Biology). View Reference
  5. Sanchez-Madrid F, Davignon D, Martz E, Springer TA. Antigens involved in mouse cytolytic T-lymphocyte (CTL)-mediated killing: functional screening and topographic relationship. Cell Immunol. 1982; 73(1):1-11. (Immunogen: Immunohistochemistry). View Reference
  6. Sanchez-Madrid F, Simon P, Thompson S, Springer TA. Mapping of antigenic and functional epitopes on the alpha- and beta-subunits of two related mouse glycoproteins involved in cell interactions, LFA-1 and Mac-1. J Exp Med. 1983; 158(2):586-602. (Clone-specific: Immunohistochemistry). View Reference
  7. Sanders VM, Vitetta ES. B cell-associated LFA-1 and T cell-associated ICAM-1 transiently cluster in the area of contact between interacting cells. Cell Immunol. 1991; 132(1):45-55. (Clone-specific: Immunohistochemistry). View Reference
  8. Springer TA, Davignon D, Ho MK, Kurzinger K, Martz E, Sanchez-Madrid F. LFA-1 and Lyt-2,3, molecules associated with T lymphocyte-mediated killing; and Mac-1, an LFA-1 homologue associated with complement receptor function. Immunol Rev. 1982; 68:171-195. (Clone-specific: Immunohistochemistry). View Reference
  9. Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994; 76(2):301-314. (Biology). View Reference
  10. Zhao Y, Iwata M. Cross-linking of the TCR-CD3 complex with CD4, CD8 or LFA-1 induces an anti-apoptotic signal in thymocytes: the signal is canceled by FK506. Int Immunol. 1995; 7(9):1387-1396. (Clone-specific: (Co)-stimulation). View Reference
View All (10) View Less
940347 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.