Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD276

BD™ AbSeq Oligo Mouse Anti-Human CD276

Clone 7-517 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
B7-H3, B7H3, 4Ig-B7-H3, B7RP-2
80381
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CCAGCAAGTCGGTAATTCGTAAGTAGAGCAGATATG
AHS0255
Human Monocyte-Derived Dendritic Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940378 Rev. 2
Antibody Details
Down Arrow Up Arrow
7-517

The 7-517 monoclonal antibody specifically binds to CD276, also known as B7-H3 (B7 homolog 3). CD276 is a type I transmembrane glycoprotein and member of the B7 family of immunoregulatory proteins. Although the CD276 gene transcript is expressed in nearly all normal tissues, the protein is preferentially expressed in tumors, tumor cell lines, sinonasal epithelial cells, and extravillous trophoblast and Hofbauer cells of the placenta. CD276 protein expression can be induced by activation of T and B lymphocytes, natural killer (NK) cells and antigen-presenting cells. The roles of CD276 in the regulation of immune responses, especially to cancer, are under investigation.  

940378 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940378 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940378" on CiteAb

Development References (6)

  1. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor alpha.. J Exp Med. 1994; 179(4):1109-18. (Methodology). View Reference
  2. Sharpe AH, Freeman GJ. The B7-CD28 superfamily.. Nat Rev Immunol. 2002; 2(2):116-26. (Biology). View Reference
  3. Steinberger P. B7-H3 ameliorates GVHD.. Blood. 2015; 125(21):3219-21. (Biology). View Reference
  4. Steinberger P1, Majdic O, Derdak SV, et al. Molecular characterization of human 4Ig-B7-H3, a member of the B7 family with four Ig-like domains.. J Immunol. 2004; 172(4):2352-2359. (Immunogen: Flow cytometry, Western blot). View Reference
  5. Sun J, Liu C, Gao L, et al. Correlation between B7-H3 expression and rheumatoid arthritis: A new polymorphism haplotype is associated with increased disease risk.. Clin Immunol. 2015; 159(1):23-32. (Biology). View Reference
  6. Sun M, Richards S, Prasad DV, Mai XM, Rudensky A, Dong C. Characterization of mouse and human B7-H3 genes.. J Immunol. 2002; 168(12):6294-7. (Biology). View Reference
View All (6) View Less
940378 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.