Oligo Mouse Anti-GATA3

BD® AbSeq Oligo Mouse Anti-GATA3

Name: Oligo Mouse Anti-GATA3
Brand: Oligo Mouse Anti-GATA3
SKU: 940521

Clone L50-823 (RUO)

Protocol Library

Scientific Resources

Protocol Library

Scientific Resources

Catalog No.:940521

Your Price:Sign In

Unit:EA (1 Each)

Size:

25 Tests

Quantity:

Add to Cart

Save To Shopping List Request Bulk Reagent Quote

Product Details

Brand: BD® AbSeq

Alternative Name: Gata-3; GATA binding protein 3; GATA-binding factor 3; HDR

Entrez Gene ID: 2625, 14462

Vol. Per Test: 2 µl/test

Isotype: Mouse BALB/c IgG1, κ

Application: Single Cell 3' Sequencing (Tested During Development)

Barcode Sequence: AGGATAGCAAAGCGAGTGAGTACGGATAGGAGAGGT

Sequence ID: AHS494

Immunogen: Conserved peptide between the trans-activation and DNA-binding domains of human, mouse and rat GATA3

Storage Buffer: Aqueous buffered solution containing BSA and ≤0.09% sodium azide.

Regulatory Status: RUO

Host Species: Mouse

Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance.

Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com.

Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Product Notices

Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
Source of all serum proteins is from USDA inspected abattoirs located in the United States.
Species cross-reactivity detected in product development may not have been confirmed on every format and/or application.
Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
Please refer to bd.com/genomics-resources for technical protocols.
Illumina is a trademark of Illumina, Inc.
For U.S. patents that may apply, see bd.com/patents.

Data Sheets

Technical Data Sheet (TDS)

Safety Data Sheet

Companion Products

Intracellular AbSeq Buffer Kit RUO

Size 1 Each Cat No. 570742

AbSeq Enhancer Kit RUO

Size 1 Each Cat No. 570750

OMICS-Guard Sample Preservation Buffer Kit RUO

Size 12 Each Cat No. 570908

RNase Inhibitor RUO

Size 1 Each Cat No. 570751

Stain Buffer (FBS) RUO

Size 500 mL Cat No. 554656

Human BD Fc Block™ RUO

Size 50 µg Cat No. 564219

View Details

940521 Rev. 2

Antibody Details

L50-823

GATA3 (GATA binding protein 3) is a member of the GATA family of transcription factors. This ~50-kDa nuclear protein regulates the development and subsequent maintenance of multiple tissues. GATA3 is involved in the development of T lymphocytes (regulates T cell receptor subunit gene expression) and the differentiation of mature T cells to become Th2 cells. The expressed levels of normal or mutant GATA3 are also associated with the behaviors of various cancer cells including estrogen receptor-positive breast carcinoma cells.

The L50-823 monoclonal antibody recognizes human and mouse GATA3.

940521 Rev. 2

Citations & References

Development References (11)

Asselin-Labat M-L, Sutherland KD, Barker H, et al. Gata-3 is an essential regulator of mammary-gland morphogenesis and luminal-cell differentiation. Nat Cell Biol. 2006; 9:201-209. (Biology).
Delgoffe GM, Pollizzi KN, Waickman AT, et al. The kinase mTOR regulates the differentiation of helper T cells through the selective activation of signaling by mTORC1 and mTORC2. Nat Immunol. 2011; 12(4):295-303. (Clone-specific: Flow cytometry). View Reference
Kouros-Mehr H, Slorach EM, Sternlicht MD, Werb Z. GATA-3 maintains the differentiation of the luminal cell fate in the mammary gland. Cell. 2006; 127:1041-1055. (Biology).
Lesourne R, Uehara S, Lee J, et al. Themis, a T cell-specific protein important for late thymocyte development. Nat Immunol. 2009; 10(8):840-847. (Clone-specific: Flow cytometry). View Reference
Marine J, Winoto A. The human enhancer-binding protein Gata3 binds to several T-cell receptor regulatory elements. Proc Natl Acad Sci U S A. 1991; 88(16):7284-7288. (Biology).
Miyamoto H, Izumi K, Yao JL, et al. GATA binding protein 3 is down-regulated in bladder cancer yet strong expression is an independent predictor of poor prognosis in invasive tumor. Hum Pathol. 2012; 43(11):2033-2040. (Clone-specific: Immunohistochemistry). View Reference
Steenbergen RDM, OudeEngberink VE, Kramer D, et al. Down-regulation of GATA-3 expression during human papillomavirus-mediated immortalization and cervical carcinogenesis. Am J Pathol. 2002; 160(6):1945-1951. (Biology). View Reference
Usary J, Llaca V, Karaca G, et al. Mutation of GATA3 in human breast tumors. Oncogene. 2004; 23(46):7669-7678. (Biology). View Reference
Yang Z, Gu L, Romeo P-H, et al. Human GATA-3 trans-activation, DNA-binding, and nuclear localization activities are organized into distinct structural domains. Mol Cell Biol. 1994; 14(3):2201-2212. (Biology). View Reference
Zheng W, Flavell RA. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. 1997; 89(4):587-596. (Biology). View Reference
van Esch H, Groenen P, Nesbit MA, et al. GATA3 haplo-insufficiency causes human HDR syndrome. Nature. 2000; 106:419-422. (Biology). View Reference

View All (11)

940521 Rev. 2

Please refer to Support Documents for Quality Certificates

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.