Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD40

BD™ AbSeq Oligo Rat Anti-Mouse CD40

Clone 3/23 (RUO)

940143
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Bp50; Tnfrsf5; TNR5; TRAP; CD40L receptor; GP39; HIGM1; IMD3; T-BAM
21939
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGTCGGAGTGTCGTAGGAGGTTGCGTATTTAGGTG
AMM2039
Mouse CD40 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940143 Rev. 2
Antibody Details
Down Arrow
3/23

The 3/23 clone monoclonal antibody specifically binds to CD40, a 40-50 kDa glycoprotein expressed on B lymphocytes and other antigen-presenting cells.  CD40 has been reported to be transiently expressed on activated CD4+ and CD8+ T cells and in some mouse strains, the 3/23 mAb has been reported to react with 5-10% of T lymphocytes in adult mouse, but not neonatal, spleen.  CD40 plays a key role in B-cell growth and differentiation where interactions of CD40 with its ligand, CD154, are involved in the initiation, effector, and memory stages of cell-mediated immune responses.  In addition, CD40 has been reported to be involved with the triggering of NK cells and NK-T cells. Ligation of CD40 with the 3/23 antibody has been reported to induce splenic B cells to express the costimulatory molecule CD86 (B7-2).  In addition, although the 3/23 antibody by itself is a weak B-cell mitogen, it has been reported to synergize markedly with mitogenic anti-IgM, anti-IgD mAb or IL-4 to promote B-cell proliferation.

940143 Rev. 2
Citations & References
Down Arrow

Development References (13)

  1. Bourgeois C, Rocha B, Tanchot C. A role for CD40 expression on CD8+ T cells in the generation of CD8+ T cell memory. Science. 2002; 297(5589):2060-2063. (Biology). View Reference
  2. Grewal IS, Flavell RA. CD40 and CD154 in cell-mediated immunity. Annu Rev Immunol. 1998; 16:111-135. (Biology). View Reference
  3. Hasbold J, Johnson-Leger C, Atkins CJ, Clark EA, Klaus GG. Properties of mouse CD40: cellular distribution of CD40 and B cell activation by monoclonal anti-mouse CD40 antibodies. Eur J Immunol. 1994; 24(8):1835-1842. (Immunogen: Activation, (Co)-stimulation). View Reference
  4. Hasbold J, Klaus GG. B cells from CBA/N mice do not proliferate following ligation of CD40. Eur J Immunol. 1994; 24(1):152-157. (Clone-specific: Activation, (Co)-stimulation). View Reference
  5. Klaus GG, Holman M, Hasbold J. Properties of mouse CD40: the role of homotypic adhesion in the activation of B cells via CD40. Eur J Immunol. 1994; 24(11):2714-2719. (Biology). View Reference
  6. Leifeld L, Trautwein C, Dumoulin FL, Manns MP, Sauerbruch T, Spengler U. Enhanced expression of CD80 (B7-1), CD86 (B7-2), and CD40 and their ligands CD28 and CD154 in fulminant hepatic failure. Am J Pathol. 1999; 154(6):1711-1720. (Biology: Immunohistochemistry). View Reference
  7. Mahnke K, Becher P, Ricciardi-Castagnoli P, Luger TA, Schawrz T Grabbe S. CD14 is expressed by subsets of murine dendritic cells and upregulated by lipopolysaccharide. In: Ricciardi-Castagnoli P, ed. Dendritic Cells in Fundamental and Clinical Immunology. New York: Plenum Press; 1997:145-159.
  8. Munder M, Mallo M, Eichmann K, Modolell M. Murine macrophages secrete interferon gamma upon combined stimulation with interleukin (IL)-12 and IL-18: A novel pathway of autocrine macrophage activation. J Exp Med. 1998; 187(12):2103-2108. (Biology). View Reference
  9. Noelle RJ, Ledbetter JA, Aruffo A. CD40 and its ligand, an essential ligand-receptor pair for thymus-dependent B-cell activation. Immunol Today. 1992; 13(11):431-433. (Biology). View Reference
  10. Parry SL, Hasbold J, Holman M, Klaus GG. Hypercross-linking surface IgM or IgD receptors on mature B cells induces apoptosis that is reversed by costimulation with IL-4 and anti-CD40. J Immunol. 1994; 152(6):2821-2829. (Biology). View Reference
  11. Parry SL, Holman MJ, Hasbold J, Klaus GG. Plastic-immobilized anti-mu or anti-delta antibodies induce apoptosis in mature murine B lymphocytes. Eur J Immunol. 1994; 24(4):974-979. (Biology). View Reference
  12. Tomura M, Yu WG, Ahn HJ, et al. A novel function of Valpha14+CD4+NKT cells: stimulation of IL-12 production by antigen-presenting cells in the innate immune system. J Immunol. 1999; 163(1):93-101. (Biology). View Reference
  13. Turner JG, Rakhmilevich AL, Burdelya L, et al. Anti-CD40 antibody induces antitumor and antimetastatic effects: the role of NK cells. J Immunol. 2001; 166(1):89-94. (Biology). View Reference
View All (13) View Less
940143 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.