pVL1392 Vector

Complete Sequence: 9639 base pairs
pH promoter 3991  -> 4091
Amp(R) 8186-9041
ColE ori 7422-8010

AAGCTTTACTCGTAAAGCGAGTTGAAGGATCATATTTAGTTGCGTTTATGAGATAAGATTGAAA
GCACGTGTAAAATGTTTCCCGCGCGTTGGCACAACTATTTACAATGCGGCCAAGTTATAAAAGA
TTCTAATCTGATATGTTTTAAAACACCTTTGCGGCCCGAGTTGTTTGCGTACGTGACTAGCGAA
GAAGATGTGTGGACCGCAGAACAGATAGTAAAACAAAACCCTAGTATTGGAGCAATAATCGATT
TAACCAACACGTCTAAATATTATGATGGTGTGCATTTTTTGCGGGCGGGCCTGTTATACAAAAA
AATTCAAGTACCTGGCCAGACTTTGCCGCCTGAAAGCATAGTTCAAGAATTTATTGACACGGTA
AAAGAATTTACAGAAAAGTGTCCCGGCATGTTGGTGGGCGTGCACTGCACACACGGTATTAATC
GCACCGGTTACATGGTGTGCAGATATTTAATGCACACCCTGGGTATTGCGCCGCAGGAAGCCAT
AGATAGATTCGAAAAAGCCAGAGGTCACAAAATTGAAAGACAAAATTACGTTCAAGATTTATTA
ATTTAATTAATATTATTTGCATTCTTTAACAAATACTTTATCCTATTTTCAAATTGTTGCGCTT
CTTCCAGCGAACCAAAACTATGCTTCGCTTGCTCCGTTTAGCTTGTAGCCGATCAGTGGCGTTG
TTCCAATCGACGGTAGGATTAGGCCGGATATTCTCCACCACAATGTTGGCAACGTTGATGTTAC
GTTTATGCTTTTGGTTTTCCACGTACGTCTTTTGGCCGGTAATAGCCGTAAACGTAGTGCCGTC
GCGCGTCACGCACAACACCGGATGTTTGCGCTTGTCCGCGGGGTATTGAACCGCGCGATCCGAC
AAATCCACCACTTTGGCAACTAAATCGGTGACCTGCGCGTCTTTTTTCTGCATTATTTCGTCTT
TCTTTTGCATGGTTTCCTGGAAGCCGGTGTACATGCGGTTTAGATCAGTCATGACGCGCGTGAC
CTGCAAATCTTTGGCCTCGATCTGCTTGTCCTTGATGGCAACGATGCGTTCAATAAACTCTTGT
TTTTTAACAAGTTCCTCGGTTTTTTGCGCCACCACCGCTTGCAGCGCGTTTGTGTGCTCGGTGA
ATGTCGCAATCAGCTTAGTCACCAACTGTTTGCTCTCCTCCTCCCGTTGTTTGATCGCGGGATC
GTACTTGCCGGTGCAGAGCACTTGAGGAATTACTTCTTCTAAAAGCCATTCTTGTAATTCTATG
GCGTAAGGCAATTTGGACTTCATAATCAGCTGAATCACGCCGGATTTAGTAATGAGCACTGTAT
GCGGCTGCAAATACAGCGGGTCGCCCCTTTTCACGACGCTGTTAGAGGTAGGGCCCCCATTTTG
GATGGTCTGCTCAAATAACGATTTGTATTTATTGTCTACATGAACACGTATAGCTTTATCACAA
ACTGTATATTTTAAACTGTTAGCGACGTCCTTGGCCACGAACCGGACCTGTTGGTCGCGCTCTA
GCACGTACCGCAGGTTGAACGTATCTTCTCCAAATTTAAATTCTCCAATTTTAACGCGAGCCAT
TTTGATACACGTGTGTCGATTTTGCAACAACTATTGTTTTTTAACGCAAACTAAACTTATTGTG
GTAAGCAATAATTAAATATGGGGGAACATGCGCCGCTACAACACTCGTCGTTATGAACGCAGAC
GGCGCCGGTCTCGGCGCAAGCGGCTAAAACGTGTTGCGCGTTCAACGCGGCAAACATCGCAAAA
GCCAATAGTACAGTTTTGATTTGCATATTAACGGCGATTTTTTAAATTATCTTATTTAATAAAT
AGTTATGACGCCTACAACTCCCCGCCCGCGTTGACTCGCTGCACCTCGAGCAGTTCGTTGACGC
CTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCAGCGGCGTGCCGCACGCGAC
GCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTCGGCCTCCAAGTGGCAATAT
TGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCTATCGTGGCGTTGGGCATGT
ACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGCGATTAGTGCGATTAAAACG
TTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAATCGAGTCAAGTGATCAAAG
TGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCGTATTTTAACAAACTAGCCA
TCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATATTATGTATCGCACGTCAAG
AATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAGAGATCAAATAAAGCGCGAA
TTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCCGGCACGAGCTTTGATTGTA
ATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGATCACGCCCAAAAGAACTGC
CGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAAGCCATCCAATCGACCGTTA
GTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGG
AGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCCGATGATT
TTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATGGCGGGGTTTTGGTCAAAAT
TTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCC
AATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAGAAAAATG
TCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAACGATTT
GAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATT
GCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCT
ACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTA
TAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGC
AAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTTGTTTT
TTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCG
TAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACA
ATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTT
TTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCCATATATGTATCTATCGTAT
AGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACCGCTGC
GCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTT
AATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCA
TAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGCACCGGATTAACATAACTTT
CCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGC
GAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAA
CTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAATTAAAATGATAACCATCTC
GCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATtC
CGGATTATTCATACCGTCCCACCATCGGGCGcggatcAGATCTGCAGCGGCCGCTCCAGAATTC
TAGAAGGTACCCGGGATCcTTTCCTGGGACCCGGCAAGAACCAAAAACTCACTCTCTTCAAGGA
AATCCGTAATGTTAAACCCGACACGATGAAGCTTGTCGTTGGATGGAAAGGAAAAGAGTTCTAC
AGGGAAACTTGGACCCGCTTCATGGAAGACAGCTTCCCCATTGTTAACGACCAAGAAGTGATGG
ATGTTTTCCTTGTTGTCAACATGCGTCCCACTAGACCCAACCGTTGTTACAAATTCCTGGCCCA
ACACGCTCTGCGTTGCGACCCCGACTATGTACCTCATGACGTGATTAGGATCGTCGAGCCTTCA
TGGGTGGGCAGCAACAACGAGTACCGCATCAGCCTGGCTAAGAAGGGCGGCGGCTGCCCAATAA
TGAACCTTCACTCTGAGTACACCAACTCGTTCGAACAGTTCATCGATCGTGTCATCTGGGAGAA
CTTCTACAAGCCCATCGTTTACATCGGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAA
GTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGT
ATTAAAACACGATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATT
TACAGACAATTGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTT
AGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAG
ATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACT
ATCTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTG
TCGATATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTT
TTGTATTTCTTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGC
TTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCC
TCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGT
CGGCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCG
TTTTTGGGCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGAT
GGTGCAGGCGGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATG
ATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGG
CGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACT
ATTGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGT
TTCTAATAGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGG
CATTGGTGGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATG
TTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTT
CGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCG
AGGCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCT
ATAAGCATTGTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAA
TTGTATTGTAAAGAGATTGTCTCAAGCTCCGCACGCCGATAACAAGCCTTTTCATTTTTACTAC
AGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAACG
TCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAA
TGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAAT
TTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGCC
ACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACTC
GGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCAA
ATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCAG
TTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAAG
TGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGCT
TTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAG
CACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGCG
TGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGTT
GGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGCG
GCGTGTTAACATACAAGTTGCTAACCGGcggttcGTAATCATGGTCATAGCTGTTTCCTGTGTG
AAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGG
GGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG
GAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTAT
TGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG
GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGA
ACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT
CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC
CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTC
CGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCA
TAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCAC
GAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGG
TAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGT
AGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTT
GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCA
AACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAA
AGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA
CGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAA
AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTT
AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC
GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGC
GAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG
CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA
GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGT
CACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAG
TTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCAT
CCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCG
GCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTA
AAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAG
CGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGG
AAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC
TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT
TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAAT
AGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACA
TGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCA
GGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATT
GTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA
TCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTC
GCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGG
TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC

pVL1393 Vector

Complete Sequence: 9639 base pairs
pH promoter 3991 -> 4091
Amp(R) 8186-9041
ColE ori 7422-8010

AAGCTTTACTCGTAAAGCGAGTTGAAGGATCATATTTAGTTGCGTTTATGAGATAAGATTGAAA
GCACGTGTAAAATGTTTCCCGCGCGTTGGCACAACTATTTACAATGCGGCCAAGTTATAAAAGA
TTCTAATCTGATATGTTTTAAAACACCTTTGCGGCCCGAGTTGTTTGCGTACGTGACTAGCGAA
GAAGATGTGTGGACCGCAGAACAGATAGTAAAACAAAACCCTAGTATTGGAGCAATAATCGATT
TAACCAACACGTCTAAATATTATGATGGTGTGCATTTTTTGCGGGCGGGCCTGTTATACAAAAA
AATTCAAGTACCTGGCCAGACTTTGCCGCCTGAAAGCATAGTTCAAGAATTTATTGACACGGTA
AAAGAATTTACAGAAAAGTGTCCCGGCATGTTGGTGGGCGTGCACTGCACACACGGTATTAATC
GCACCGGTTACATGGTGTGCAGATATTTAATGCACACCCTGGGTATTGCGCCGCAGGAAGCCAT
AGATAGATTCGAAAAAGCCAGAGGTCACAAAATTGAAAGACAAAATTACGTTCAAGATTTATTA
ATTTAATTAATATTATTTGCATTCTTTAACAAATACTTTATCCTATTTTCAAATTGTTGCGCTT
CTTCCAGCGAACCAAAACTATGCTTCGCTTGCTCCGTTTAGCTTGTAGCCGATCAGTGGCGTTG
TTCCAATCGACGGTAGGATTAGGCCGGATATTCTCCACCACAATGTTGGCAACGTTGATGTTAC
GTTTATGCTTTTGGTTTTCCACGTACGTCTTTTGGCCGGTAATAGCCGTAAACGTAGTGCCGTC
GCGCGTCACGCACAACACCGGATGTTTGCGCTTGTCCGCGGGGTATTGAACCGCGCGATCCGAC
AAATCCACCACTTTGGCAACTAAATCGGTGACCTGCGCGTCTTTTTTCTGCATTATTTCGTCTT
TCTTTTGCATGGTTTCCTGGAAGCCGGTGTACATGCGGTTTAGATCAGTCATGACGCGCGTGAC
CTGCAAATCTTTGGCCTCGATCTGCTTGTCCTTGATGGCAACGATGCGTTCAATAAACTCTTGT
TTTTTAACAAGTTCCTCGGTTTTTTGCGCCACCACCGCTTGCAGCGCGTTTGTGTGCTCGGTGA
ATGTCGCAATCAGCTTAGTCACCAACTGTTTGCTCTCCTCCTCCCGTTGTTTGATCGCGGGATC
GTACTTGCCGGTGCAGAGCACTTGAGGAATTACTTCTTCTAAAAGCCATTCTTGTAATTCTATG
GCGTAAGGCAATTTGGACTTCATAATCAGCTGAATCACGCCGGATTTAGTAATGAGCACTGTAT
GCGGCTGCAAATACAGCGGGTCGCCCCTTTTCACGACGCTGTTAGAGGTAGGGCCCCCATTTTG
GATGGTCTGCTCAAATAACGATTTGTATTTATTGTCTACATGAACACGTATAGCTTTATCACAA
ACTGTATATTTTAAACTGTTAGCGACGTCCTTGGCCACGAACCGGACCTGTTGGTCGCGCTCTA
GCACGTACCGCAGGTTGAACGTATCTTCTCCAAATTTAAATTCTCCAATTTTAACGCGAGCCAT
TTTGATACACGTGTGTCGATTTTGCAACAACTATTGTTTTTTAACGCAAACTAAACTTATTGTG
GTAAGCAATAATTAAATATGGGGGAACATGCGCCGCTACAACACTCGTCGTTATGAACGCAGAC
GGCGCCGGTCTCGGCGCAAGCGGCTAAAACGTGTTGCGCGTTCAACGCGGCAAACATCGCAAAA
GCCAATAGTACAGTTTTGATTTGCATATTAACGGCGATTTTTTAAATTATCTTATTTAATAAAT
AGTTATGACGCCTACAACTCCCCGCCCGCGTTGACTCGCTGCACCTCGAGCAGTTCGTTGACGC
CTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCAGCGGCGTGCCGCACGCGAC
GCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTCGGCCTCCAAGTGGCAATAT
TGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCTATCGTGGCGTTGGGCATGT
ACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGCGATTAGTGCGATTAAAACG
TTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAATCGAGTCAAGTGATCAAAG
TGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCGTATTTTAACAAACTAGCCA
TCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATATTATGTATCGCACGTCAAG
AATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAGAGATCAAATAAAGCGCGAA
TTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCCGGCACGAGCTTTGATTGTA
ATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGATCACGCCCAAAAGAACTGC
CGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAAGCCATCCAATCGACCGTTA
GTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGG
AGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCCGATGATT
TTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATGGCGGGGTTTTGGTCAAAAT
TTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCC
AATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAGAAAAATG
TCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAACGATTT
GAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATT
GCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCT
ACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTA
TAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGC
AAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTTGTTTT
TTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCG
TAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACA
ATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTT
TTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCCATATATGTATCTATCGTAT
AGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACCGCTGC
GCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTT
AATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCA
TAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGCACCGGATTAACATAACTTT
CCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGC
GAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAA
CTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAATTAAAATGATAACCATCTC
GCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATtC
CGGATTATTCATACCGTCCCACCATCGGGCGCgGATCCCGGGTACCTTCTAGAATTCCGGAGCG
GCCGCTGCAGATCTgatccTTTCCTGGGACCCGGCAAGAACCAAAAACTCACTCTCTTCAAGGA
AATCCGTAATGTTAAACCCGACACGATGAAGCTTGTCGTTGGATGGAAAGGAAAAGAGTTCTAC
AGGGAAACTTGGACCCGCTTCATGGAAGACAGCTTCCCCATTGTTAACGACCAAGAAGTGATGG
ATGTTTTCCTTGTTGTCAACATGCGTCCCACTAGACCCAACCGTTGTTACAAATTCCTGGCCCA
ACACGCTCTGCGTTGCGACCCCGACTATGTACCTCATGACGTGATTAGGATCGTCGAGCCTTCA
TGGGTGGGCAGCAACAACGAGTACCGCATCAGCCTGGCTAAGAAGGGCGGCGGCTGCCCAATAA
TGAACCTTCACTCTGAGTACACCAACTCGTTCGAACAGTTCATCGATCGTGTCATCTGGGAGAA
CTTCTACAAGCCCATCGTTTACATCGGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAA
GTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGT
ATTAAAACACGATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATT
TACAGACAATTGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTT
AGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAG
ATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACT
ATCTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTG
TCGATATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTT
TTGTATTTCTTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGC
TTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCC
TCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGT
CGGCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCG
TTTTTGGGCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGAT
GGTGCAGGCGGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATG
ATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGG
CGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACT
ATTGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGT
TTCTAATAGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGG
CATTGGTGGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATG
TTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTT
CGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCG
AGGCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCT
ATAAGCATTGTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAA
TTGTATTGTAAAGAGATTGTCTCAAGCTCCGCACGCCGATAACAAGCCTTTTCATTTTTACTAC
AGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAACG
TCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAA
TGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAAT
TTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGCC
ACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACTC
GGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCAA
ATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCAG
TTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAAG
TGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGCT
TTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAG
CACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGCG
TGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGTT
GGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGCG
GCGTGTTAACATACAAGTTGCTAACCGGcggttcGTAATCATGGTCATAGCTGTTTCCTGTGTG
AAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGG
GGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGG
GAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTAT
TGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG
GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGA
ACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTT
CCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC
CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTC
CGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCA
TAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCAC
GAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGG
TAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGT
AGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTT
GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCA
AACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAA
AGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA
CGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAA
AATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTT
AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC
GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGC
GAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCG
CAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA
GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGT
CACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAG
TTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCAT
CCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCG
GCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTA
AAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAG
CGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGG
AAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTC
TCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT
TCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAAT
AGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACA
TGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCA
GGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATT
GTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCA
TCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTC
GCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGG
TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC