pAcHLT A Vector

Complete Sequence: 8112 basepairs
pH promoter: 2091-2191
His Linker ORF: 2206-2400
Amp(R): 6077->6937
ColE ori: 7108-7696

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATAGATCCGATGGGACATCATCATCA
TCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCCCAGGA
CTCGATGGCATATGCTCGATCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTGCAGGG
TACCCCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTGG
TGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAAAACAC
GATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAAT
TGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAA
TCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTGTAAAA
TAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTAATGGA
TTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCG
TTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTCT
TTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATAT
TTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTCGTTAG
AAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCTAACAC
GTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCG
GGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCG
GTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTAC
CATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGATGCA
GACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGTACTGG
TTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGC
TTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGA
GCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGG
GAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGCACGAT
TGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCAGCGCT
TGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATTG
TAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGTA
AAGAGATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTAC
AGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAACG
TCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAA
TGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAAT
TTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGCC
ACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACTC
GGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCAA
ATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCAG
TTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAAG
TGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGCT
TTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAG
CACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGCG
TGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGTT
GGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGCG
GCGTGTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGACGAAAT
GTTGGACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAACACGTT
CGTAACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAGACTCA
CAAATTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTACGAGTA
GAATTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCA
ACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACC
GATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCC
TTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGC
GGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCC
TAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCA
AGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAA
AAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTT
TGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCC
TATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAAT
GAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGT
GCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACC
CGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTC
TCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCC
TCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGG
CACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATG
TATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGA
GTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGC
TCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTAC
ATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAA
TGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGA
GCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAA
AAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATA
ACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCA
CAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCA
AACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTG
GCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGC
AGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGT
GAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAG
TTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGG
TGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGAT
TTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCA
AAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATC
TTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCA
GCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCA
GAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTC
TGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGAT
AAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCT
GAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCT
ACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTA
AGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTT
ATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGG
GCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCT
TTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG
AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGC
GGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGG
CACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCA
CTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAG
CGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT

pAcHLT B Vector

Complete Sequence: 8110 basepairs
pH promoter 2091-2191
His Linker ORF 2206-2442
Amp(R) 6075 -> 6935
ColE ori 7106-7694

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATAGATCCGATGGGACATCATCATCA
TCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCCCAGGA
CTCGATGGCATATATGCTCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTGCAGGGTA
CCCCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTGGTG
TTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAAAACACGA
TACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAATTG
TTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAATC
AAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTGTAAAATA
GGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTAATGGATT
TTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCGTT
TGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTCTTT
CATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATATTT
AACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTCGTTAGAA
GTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCTAACACGT
CCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCGGG
TTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCGGT
GGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTACCA
TCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGATGCAGA
CGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGTACTGGTT
TCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGCTT
CCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGC
GGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGGGA
GAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGCACGATTG
TGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCAGCGCTTG
GGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATTGTA
ATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGTAAA
GAGATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTACAG
CATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAACGTC
GTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAATG
TTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAATTT
TGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGCCAC
CACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACTCGG
TATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCAAAT
TGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCAGTT
AATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAAGTG
ATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGCTTT
CGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAGCA
CAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGCGTG
TATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGTTGG
AGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGCGGC
GTGTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGACGAAATGT
TGGACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAACACGTTCG
TAACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAGACTCACA
AATTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTACGAGTAGA
ATTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAAC
TTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGA
TCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTT
ACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGG
CGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTA
GCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAG
CTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAA
ACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTG
ACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTA
TCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGA
GCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGC
ACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCG
CTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTC
CGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTC
GTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCA
CTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTA
TCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGT
ATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTC
ACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACAT
CGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATG
ATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGC
AACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAA
GCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAAC
ACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACA
ACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAA
CGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGC
GAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAG
GACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGA
GCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTT
ATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTG
CCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTT
AAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAA
ATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTT
CTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGC
GGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGA
GCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTG
TAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAA
GTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGA
ACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTAC
AGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAG
CGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTAT
AGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGC
GGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTT
TGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAG
TGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGG
AAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCA
CGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACT
CATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCG
GATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT

pAcHLT C Vector

Complete Sequence: 8108
pH promoter 2091-2191
His Linker ORF 2206-2487
Amp(R) 6073->6933
ColE ori 7104-7692

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATAGATCCGATGGGACATCATCATCA
TCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCCCAGGA
CTCGATGGCATATGCTCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTGCAGGGTACC
CCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTGGTGTT
CAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAAAACACGATA
CATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAATTGTT
GTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAATCAA
ATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTGTAAAATAGG
TTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTAATGGATTTT
CGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCGTTTG
TGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTCTTTCA
TCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATATTTAA
CATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTCGTTAGAAGT
TGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCTAACACGTCC
GCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCGGGTT
TCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCGGTGG
TAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTACCATC
GGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGATGCAGACG
GCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGTACTGGTTTC
GGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGCTTCC
AACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGCGG
GCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGGGAGA
AGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGCACGATTGTG
GGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCAGCGCTTGGG
GTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATTGTAAT
TTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGTAAAGA
GATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTACAGCA
TTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAACGTCGT
TGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAATGTT
GTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAATTTTG
TTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGCCACCA
CAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACTCGGTA
TAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCAAATTG
TATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCAGTTAA
TGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAAGTGAT
CGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGCTTTCG
TACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAGCACA
ATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGCGTGTA
TGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGTTGGAG
TATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGCGGCGT
GTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGACGAAATGTTG
GACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAACACGTTCGTA
ACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAGACTCACAAA
TTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTACGAGTAGAAT
TAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT
AATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATC
GCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTAC
GCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCG
CATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGC
GCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCT
CTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAAC
TTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGAC
GTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATC
TCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGC
TGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCAC
TCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCT
GACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCTCCG
GGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGT
GATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACT
TTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATC
CGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTAT
TCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCAC
CCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCG
AACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGAT
GAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAA
CTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGC
ATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACAC
TGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAAC
ATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACG
ACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGA
ACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGA
CCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGC
GTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTAT
CTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCC
TCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAA
AACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAAT
CCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCT
TGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGG
TGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGC
GCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTA
GCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT
CGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAAC
GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAG
CGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCG
GCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAG
TCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGG
AGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTG
CTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTG
AGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAA
GAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACG
ACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCA
TTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGA
TAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT