Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse H2-Ld/H-2Db

BD™ AbSeq Oligo Mouse Anti-Mouse H2-Ld/H-2Db

Clone 28-14-8 (RUO)

제품 세부 정보
Down Arrow Up Arrow


BD™ AbSeq
H-2Db/H-2Ld; H2-Db/H2-Ld; Histocompatibility-2 Db/Ld
14964
2 µl
Mouse C3H, also known as C3H/He, C3H/Bi IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TCATGGTAGTGGGCCGAGATAGTTAGTTAGTGTAGG
AMM2177
C3H.SW mouse splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


준비 및 보관

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

권장 분석 절차

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

제품 고시

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

관련 제품

Stain Buffer (FBS) RUO
사이즈 500 ML 카탈로그 No. 554656
sampleImage/
Single-Cell Analysis System RUO
사이즈 1 EA 카탈로그 No. 633701
sampleImage/
Express Single-Cell Analysis System Package RUO
사이즈 1 EA 카탈로그 No. 633707
sampleImage/
Targeted mRNA and AbSeq Training Kit 4 Pack RUO
사이즈 1 Each 카탈로그 No. 633772
sampleImage/
940420 Rev. 2
항체 세부 정보
Down Arrow Up Arrow
28-14-8

The 28-14-8 antibody reacts with the α3 domain of the H-2D[b] MHC class I alloantigen.  The antibody binds to H-2D[b] in the presence or absence of the β2 microglobulin chain.  It cross-reacts with the α3 domain of H-2L[d], but not with K[d] or D[d], and with H-2D[q] and/or L[q].  Reactivity with haplotypes k, f, p, r, and s has not been observed.  mAb 28-14-8 has been shown to block H-2L[d]- specific and H- 2L[d]-restricted antigen-specific lysis of target cells by cytotoxic T lymphocytes (CTL),  but it does not block recognition of H-2L[d] positive target cells by Ly-6G2-positive NK cells.

940420 Rev. 2
형광 세부 정보
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940420 Rev.2
인용 및 참고 문헌
Down Arrow Up Arrow
View product citations for antibody "940420" on CiteAb

개발 참고 자료 (9)

  1. Allen H, Fraser J, Flyer D, Calvin S, Flavell R. Beta 2-microglobulin is not required for cell surface expression of the murine class I histocompatibility antigen H-2Db or of a truncated H-2Db. Proc Natl Acad Sci U S A. 1986; 83(19):7447-7451. (Clone-specific: Immunoprecipitation). 참조 보기
  2. Allen H, Wraith D, Pala P, Askonas B, Flavell RA. Domain interactions of H-2 class I antigens alter cytotoxic T-cell recognition sites. Nature. 1984; 309(5965):279-281. (Clone-specific: Radioimmunoassay). 참조 보기
  3. Evans GA, Margulies DH, Shykind B, Seidman JG, Ozato K. Exon shuffling: mapping polymorphic determinants on hybrid mouse transplantation antigens. Nature. 1982; 300(5894):755-757. (Clone-specific: Radioimmunoassay). 참조 보기
  4. Kündig TM, Bachmann MF, DiPaolo C. Fibroblasts as efficient antigen-presenting cells in lymphoid organs. Science. 1995; 268(5215):1343-1347. (Clone-specific: Blocking). 참조 보기
  5. Mason LH, Ortaldo JR, Young HA, Kumar V, Bennett M, Anderson SK. Cloning and functional characteristics of murine large granular lymphocyte-1: a member of the Ly-49 gene family (Ly-49G2). J Exp Med. 1995; 182(2):293-303. (Clone-specific: Blocking). 참조 보기
  6. Orn A, Goodenow RS, Hood L. Product of a transferred H-2Ld gene acts as restriction element for LCMV-specific killer T cells. Nature. 1982; 297(5865):415. (Clone-specific: Blocking). 참조 보기
  7. Ozato K, Hansen TH, Sachs DH. Monoclonal antibodies to mouse MHC antigens. II. Antibodies to the H-2Ld antigen, the products of a third polymorphic locus of the mouse major histocompatibility complex. J Immunol. 1980; 125(6):2473-2477. (Immunogen: Cytotoxicity). 참조 보기
  8. Ozato K, Sachs DH. Monoclonal antibodies to mouse MHC antigens. III. Hybridoma antibodies reacting to antigens of the H-2b haplotype reveal genetic control of isotype expression. J Immunol. 1981; 126(1):317-321. (Immunogen: Cytotoxicity). 참조 보기
  9. Woodward JG, Orn A, Harmon RC, Goodenow RS, Hood L, Frelinger JA. Specific recognition of the product of a transferred major histocompatibility complex gene by cytotoxic T lymphocytes. Proc Natl Acad Sci U S A. 1982; 79(11):3613-3617. (Clone-specific: Blocking). 참조 보기
모두 보기 (9) 간단히 보기
940420 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.