Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD19

BD™ AbSeq Oligo Mouse Anti-Human CD19

Clone HIB19

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
B4; B-lymphocyte antigen CD19; Leu-12
930
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGCGGTAAATCGGGAGTAAGTCGTGTTCTAGCAGT
AHS0161
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940247 Rev. 2
Antibody Details
Down Arrow Up Arrow
HIB19

The HIB19 monoclonal antibody specifically binds to the 95 kDa type I transmembrane CD19 glycoprotein. CD19 is expressed during all stages of B-cell maturation and differentiation, except on plasma cells. CD19 is also present on follicular dendritic cells. It is not found on T cells or on normal granulocytes. CD19 is a signal transduction molecule that regulates B cell development, activation, proliferation and differentiation. It associates with the complement receptor 2 (CD21), TAPA-1 (CD81), Leu 13, and/or MHC class II to form a signal transduction complex on the surface of B cells. Anti-CD19 clone HIB19 partially blocks the binding of clone B43, another CD19-specific monoclonal antibody.

940247 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940247 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Bradbury LE, Goldmacher VS, Tedder TF. The CD19 signal transduction complex of B lymphocytes. Deletion of the CD19 cytoplasmic domain alters signal transduction but not complex formation with TAPA-1 and Leu 13. J Immunol. 1993; 151(6):2915-2927. (Biology). View Reference
  2. Favaloro EJ, Moraitis N, Koutts J, Exner T, Bradstock KF. Endothelial cells and normal circulating haemopoietic cells share a number of surface antigens. Thromb Haemost. 1989; 61(2):217-224. (Biology). View Reference
  3. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  4. Nadler LM, Anderson KC, Marti G, et al. B4, a human B lymphocyte-associated antigen expressed on normal, mitogen-activated, and malignant B lymphocytes. J Immunol. 1983; 131(1):244-250. (Biology). View Reference
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Uckun FM, Muraguchi A, Ledbetter JA, et al. Biphenotypic leukemic lymphocyte precursors in CD2+CD19+ acute lymphoblastic leukemia and their putative normal counterparts in human fetal hematopoietic tissues. Blood. 1989; 73(4):1000-1015. (Biology). View Reference
View All (6) View Less
940247 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.