Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD116

BD™ AbSeq Oligo Mouse Anti-Human CD116

Clone hGMCSFR-M1

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CSF2RA; GM-CSF Receptor alpha; GM-CSFRα; GMCSFRA; GMR, SMDP4
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTTAGTTGTAGGATCGAGAGTAGGTGTGCATTGCGT
AHS0238
Recombinant human GM-CSFR
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940311 Rev. 2
Antibody Details
Down Arrow Up Arrow
hGMCSFR-M1

The hGMCSFR-M1 antibody reacts with the subunit (GM-CSFR) of the human Granulocyte-Macrophage Colony-Stimulating Factor Receptor complex. This 75-85 kD subunit is also known as CD116. The hGMCSFR-M1 antibody was first clustered at the Fifth International Workshop on Human Leucocyte Differentiation Antigens. The GM-CSFR subunit associates with the 120-140 kD βc subunit (common subunit, CD131), that is shared with the receptors for interleukins IL-3 and IL-5. Both of the chains of the GM-CSFR complex are involved in ligand binding and intracellular signaling. The α chain appears to transmit most of the biological signals. CD116 is expressed by a variety of myeloid cell lines, hematopoietic and non-hematopoetic tumor cells, and normal cell types including monocytes, macrophages, neutrophils, eosinophils, myeloid dendritic cells, endothelial cells, fibroblasts, and placental trophoblasts. Lymphocytes are negative for GM-CSFR expression. Reports suggest that GM-CSFR plays a role in myeloid lineage growth and differentiation. The immunogen used to generate the hGMCSFR-M1 hybridoma was recombinant human GM-CSFR.

940311 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940311 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (9)

  1. Eder M, Ernst TJ, Ganser A, et al. low affinity chimeric human alpha/beta-granulocyte-macrophage colony-stimulating factor receptor induces ligand-dependent proliferation in a murine cell line. J Biol Chem. 1994 ; 269(48):30173-30180. (Biology). View Reference
  2. Jokhi PP, King A, Jubinsky PT, Loke YW. Demonstration of the low affinity alpha subunit of the granulocyte-macrophage colony-stimulating factor receptor (GM-CSF-R alpha) on human trophoblast and uterine cells. J Reprod Immunol. 1994; 26(2):147-164. (Biology). View Reference
  3. Jubinsky PT, Laurie AS, Nathan DG, Yetz-Aldepe J, Sieff CA. Expression and function of the human granulocyte-macrophage colony-stimulating factor receptor alpha subunit. Blood. 1994; 84(12):4174-4185. (Biology). View Reference
  4. Kubista B, Trieb K, Herbacek I, Micksche. Effect of granulocyte-macrophage colony-stimulating factor on natural-killer cell mediated cytotoxicity. Int J Biochem Cell Biol. 2003; 35(7):1056-1060. (Clone-specific: Flow cytometry). View Reference
  5. Lanza F, Moretti S, Papa S, Malavasi F, Castoldi G. Report on the Fifth International Workshop on Human Leukocyte Differentiation Antigens, Boston, November 3-7, 1993.. Haematologica. 79(4):374-86. (Clone-specific: Flow cytometry). View Reference
  6. Ronco LV, Silverman SL, Wong SG, Slamon DJ, Park LS, Gasson JC. Identification of conserved amino acids in the human granulocyte-macrophage colony-stimulating factor receptor alpha subunit critical for function. Evidence for formation of a heterodimeric receptor complex prior to ligand binding. J Biol Chem. 1994; 269(1):277-283. (Biology). View Reference
  7. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  8. Stacchini A, Fubini L, Aglietta M. Flow cytometric detection and quantitative analysis of the GM-CSF receptor in human granulocytes and comparison with the radioligand binding assay. Cytometry. 1996; 24(4):374-381. (Clone-specific: Flow cytometry). View Reference
  9. Wognum AW, Westerman Y, Visser TP, Wagemaker G. Distribution of receptors for granulocyte-macrophage colony-stimulating factor on immature CD34+ bone marrow cells, differentiating monomyeloid progenitors, and mature blood cell subsets. Blood. 1994; 84(3):764-774. (Biology). View Reference
View All (9) View Less
940311 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.