Skip to main content Skip to navigation
Oligo Rat Anti-Mouse TER-119/Erythroid Cells

BD™ AbSeq Oligo Rat Anti-Mouse TER-119/Erythroid Cells

Clone TER-119

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Lymphocyte antigen 76; Ly76; Ly-76; TER-119; Ter119
104231
2 µl
Rat WI, also known as Wistar (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTCGTGGTCGGATAGCGTGTAGGTTTAAAGTAGAGG
AMM2028
Mouse Fetal Liver
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940132 Rev. 2
Antibody Details
Down Arrow Up Arrow
TER-119

The TER-119 antibody specifically binds to a 52 kDa molecule associated with glycophorin A on cells of the erythroid lineage in embryonic yolk sac, fetal liver, newborn liver, adult bone marrow, adult peripheral blood, and adult lymphoid organs. The TER-119 antigen is expressed on erythroid cells from pro-erythroblast through mature erythrocyte stages, but not on cells with BFU-E or CFU-E activities. The TER-119 epitope is not detected on hematopoietic stem cells, lymphoid cells, myeloid cells, or erythroleukemia lines. The TER-119 mAb is a component of the "lineage cocktail" used in studies of hematopoietic progenitors to detect, or deplete cells committed to the hematopoietic lineages.

940132 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940132 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Ikuta K, Kina T, MacNeil I, et al. A developmental switch in thymic lymphocyte maturation potential occurs at the level of hematopoietic stem cells. Cell. 1990; 62(5):863-874. (Clone-specific). View Reference
  2. Kina T, Ikuta K, Takayama E, et al. The monoclonal antibody TER-119 recognizes a molecule associated with glycophorin A and specifically marks the late stages of murine erythroid lineage. Br J Haematol. 2000; 109(2):280-287. (Immunogen: Immunoprecipitation, Western blot). View Reference
  3. Kitajima K, Kojima M, Nakajima K, et al. Definitive but not primitive hematopoiesis is impaired in jumonji mutant mice. Blood. 1999; 93(1):87-95. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  4. Maraskovsky E, Brasel K, Teepe M, et al. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med. 1996; 184(5):1953-1962. (Clone-specific: Cell separation, Cytotoxicity, Depletion, Flow cytometry). View Reference
  5. Osawa M, Tokumoto Y, Nakauchi H. Hematopoietic stem cells. In: Herzenberg LA, Weir DM, Blackwell C, ed. Weir's Handbook of Experimental Immunology, 5th Edition. Cambridge: Blackwell Science; 1996:66.1-66.5.
940132 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.