Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Siglec-F

BD™ AbSeq Oligo Rat Anti-Mouse Siglec-F

Clone E50-2440

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD170; SIGL5; Siglec-5; Siglec5; Siglecf; sialic acid-binding Ig-like lectin 5; siglec-5
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTAAGAAGTGCGTATGAGTAGGAACCGGTGTATTTG
AMM2013
Mouse Siglec-F and human IgG Fc recombinant fusion protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940117 Rev. 3
Antibody Details
Down Arrow Up Arrow
E50-2440

The E50-2440 monoclonal antibody specifically recognizes Siglec-F. Siglecs are the sialic acid-binding immunoglobulin superfamily lectins defined in the human, each of which has a distinctive expression pattern in the hematopoietic system and at least some of which are known to mediate cell-cell interactions. Orthologous proteins of human Siglec-1 (Sialoadhesin or CD169), Siglec-2 (CD22), and Siglec-4 (myelin-associated glycoprotein) have been characterized in the mouse. Human Siglec-3 (CD33) and Siglecs-5 through -10 are encoded by a cluster of closely related genes, and each has two cytoplasmic ITIM (Immunoreceptor Tyrosine-based Inhibitory Motifs). Similarly, mouse Siglec-F is encoded by the Siglecf gene in a syntenic cluster in the mouse, and the protein has sialic acid-binding activity and an intracytoplasmic ITIM. Its expression pattern differs from those of the human Siglec-3-related proteins in that it is found on immature cells of the myelomonocytic lineage, with reduced expression on mature neutrophils and monocytes, and not on lymphoid cells. It has been proposed that mAb E50-2440 may be used for identification of immature myelomonocytic cells in the mouse.

940117 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940117 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (2)

  1. Angata T, Hingorani R, Varki NM, Varki A. Cloning and characterization of a novel mouse Siglec, mSiglec-F: differential evolution of the mouse and human (CD33) Siglec-3-related gene clusters. J Biol Chem. 2001; 276(48):45128-45136. (Immunogen: Flow cytometry, Fluorescence activated cell sorting). View Reference
  2. Crocker PR, Varki A. Siglecs, sialic acids and innate immunity. Trends Immunol. 2001; 22(6):337-342. (Biology). View Reference
940117 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.