Skip to main content Skip to navigation
Hamburger Menu
Search icon
Country Selector Country Selector
Middle East / Africa (English)
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
    Alert Icon
    Oligo Mouse Anti-Mouse H-2Kb

    BD™ AbSeq Oligo Mouse Anti-Mouse H-2Kb

    Clone AF6-88.5

    (RUO)
    Product Details
    Down Arrow Up Arrow


    BD™ AbSeq
    H2 class I histocompatibility alloantigen Kb
    14972
    2 µl
    Mouse BALB/c IgG2a, κ
    Mouse (Tested in Development)
    Single Cell 3' Sequencing (Qualified)
    CGGTATATATCTCGGAGGTAAGCGTCGCGGAAATGT
    AMM2060
    Mouse C57BL/6 Splenocytes
    Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
    RUO
    Mouse


    Preparation And Storage

    Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
    Show More blue down arrow Show Less blue up arrow

    Recommended Assay Procedures

    Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

    BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

    Show More blue down arrow Show Less blue up arrow

    Product Notices

    1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
    2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
    3. Please refer to bd.com/genomics-resources for technical protocols.
    4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
    5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
    6. Illumina is a trademark of Illumina, Inc.
    7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
    8. For U.S. patents that may apply, see bd.com/patents.
    Show More blue down arrow Show Less blue up arrow
    940164 Rev. 2
    Antibody Details
    Down Arrow Up Arrow
    AF6-88.5

    The AF6-88.5 antibody recognizes the H-2Kb MHC class I alloantigen. Reactivity with other haplotypes (e.g., d, f, j, k, p, q, r, s, u, v) has not been observed.

    940164 Rev. 2
    Format Details
    Down Arrow Up Arrow
    Antibody-Oligo
    The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
    Antibody-Oligo
    940164 Rev.2
    Citations & References
    Down Arrow Up Arrow

    Development References (2)

    1. Pérarnau B, Saron MF, Reina San Martin B, et al. Single H2Kb, H2Db and double H2KbDb knockout mice: peripheral CD8+ T cell repertoire and anti-lymphocytic choriomeningitis virus cytolytic responses.. Eur J Immunol. 1999; 29(4):1243-52. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
    2. Wall KA, Lorber MI, Loken MR, McClatchey S, Fitch FW. Inhibition of proliferation of MIs- and Ia-reactive cloned T cells by a monoclonal antibody against a determinant shared by I-A and I-E.. J Immunol. 1983; 131(3):1056-64. (Clone-specific: Blocking, Flow cytometry, Immunoprecipitation). View Reference
    940164 Rev. 2

    Please refer to Support Documents for Quality Certificates


    Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


    Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

    For Research Use Only. Not for use in diagnostic or therapeutic procedures.

    Website Feedback