Skip to main content Skip to navigation
Oligo Mouse Anti-Human Notch1

BD™ AbSeq Oligo Mouse Anti-Human Notch1

Clone MHN1-519

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
NOTCH1; Notch 1; NOTC1; hN1; TAN1; Neurogenic locus notch homolog protein 1
4851
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTAGTAGGAGCGTGTTTCATCGGCATTATCGTTTG
AHS0214
Human Notch1 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940292 Rev. 2
Antibody Details
Down Arrow Up Arrow
MHN1-519

The MHN1-519 monoclonal antibody specifically binds to an extracellular domain of human Notch1. Notch1 is a type 1 transmembrane glycoprotein receptor and member of the Notch family that includes Notch1-Notch4. Notch1 is cleaved in the Golgi and presents as a cell surface heterodimeric receptor. The Notch1 receptor can bind to several membrane-bound ligands including Jagged1, Jagged2, Delta1 and Delta4. Upon ligand binding, Notch1 undergoes proteolytic cleavage that results in the release of the Notch intracellular domain, NICD. NICD translocates to the nucleus where it forms a transcriptional activator complex with various transcriptional factors. These multimeric complexes either positively or negatively regulate the expression of multiple genes including those that orchestrate many facets of embryonic development and the subsequent functioning of multiple organ systems such as the immune, cardiovascular and nervous systems. Within the immune system, Notch signaling significantly affects the development, proliferation, differentiation and survival of numerous cell types including thymocytes and subsets of T and B lymphocytes and dendritic cells. In altered forms, Notch1 has been associated with certain cardiovascular diseases and with some lymphocyte neoplasms.

940292 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940292 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Auderset F, Coutaz M, Tacchini-Cottier F. The role of Notch in the differentiation of CD4(+) T helper cells. Curr Top Microbiol Immunol. 2012; 360:115-134. (Biology). View Reference
  2. Chiba S. Notch signaling in stem cell systems. Stem Cells. 2006; 24(11):2437-2447. (Biology). View Reference
  3. Ellisen LW, Bird J, West DC, et al. TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell. 1991; 66(4):649-661. (Biology). View Reference
  4. Haraguchi K, Suzuki T, Koyama N et al. Notch activation induces the generation of functional NK cells from human cord blood CD34-positive cells devoid of IL-15. J Immunol. 2009; 182(10):6168-6178. (Immunogen: Blocking, ELISA, Flow cytometry, Inhibition). View Reference
  5. Milner LA, Kopan R, Martin DI, Bernstein ID. A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors. Blood. 1994; 83(8):2057-2062. (Biology). View Reference
  6. Yamanda S, Ebihara S, Asada M, et al. Role of ephrinB2 in nonproductive angiogenesis induced by Delta-like 4 blockade. Blood. 2009; 113(15):3631-3639. (Clone-specific: Flow cytometry). View Reference
View All (6) View Less
940292 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.