Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD7

BD™ AbSeq Oligo Mouse Anti-Human CD7

Clone M-T701

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
GP40; LEU-9; T-cell leukemia antigen; Tp40; TP41
924
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTATGTAGGTCTTATGTGTTGGCGTAGTATGCGTTT
AHS0043
P-CLL and Jurkat Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940029 Rev. 3
Antibody Details
Down Arrow Up Arrow
M-T701

The M-T701 monoclonal antibody specifically binds to CD7. CD7 is a 40 kDa type I transmembrane glycoprotein that belongs to the immunoglobulin superfamily.  The CD7 antigen is also known as Leu-9, TP41, Tp40, GP40, and T-cell leukemia antigen. It is expressed on thymocytes, T cells, pre-B cells, and NK cells. CD7 is present in reduced density on monocytic cells and cell lines. Functional studies demonstrate that crosslinking of the CD7 can induce transmembrane calcium flux in T cells.

940029 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940029 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  2. Pace KE, Lee C, Stewart PL, Baum LG. Restricted receptor segregation into membrane microdomains occurs on human T cells during apoptosis induced by galectin-1. J Immunol. 1999; 163(7):3801-3811. (Clone-specific: Fluorescence microscopy, Functional assay, Immunofluorescence). View Reference
  3. Rabinowich H, Pricop L, Herberman RB, Whiteside TL. Expression and function of CD7 molecule on human natural killer cells. J Immunol. 1994; 152(2):517-526. (Biology). View Reference
  4. Reiter C. Cluster report: CD7. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:341-342.
  5. Rosenzweig M, Marks DF, DeMaria MA, Connole M, Johnson RP. Identification of primitive hematopoietic progenitor cells in the rhesus macaque. J Med Primatol. 2001; 30(1):36-45. (Clone-specific: Flow cytometry). View Reference
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (6) View Less
940029 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.