Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD329 (Siglec-9)

BD™ AbSeq Oligo Mouse Anti-Human CD329 (Siglec-9)

Clone E10-286

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Siglec-9; Siglec Y; FOAP-9; OBBP-LIKE
27180
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGGGCGCGAAGATAGGATAATAGGTAACGTCAAATG
AHS0239
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940312 Rev. 2
Antibody Details
Down Arrow Up Arrow
E10-286

The E10-286 monoclonal antibody specifically binds to CD329. CD329 is also known as Sialic acid-binding Ig-like lectin 9 (Siglec-9), formerly known as Siglec-Y, which is expressed on peripheral blood monocytes, granulocytes and NK cells. Siglecs (sialic acid/immunolgobulin/lectin) are a family of I-type lectins binding to sialic acids on the cell surface. They are a family of carbohydrate-binding proteins within the immunoglobulin superfamily.  Siglecs are all integral membrane proteins with extracellular domains consisting of unusual N-termial V-set Ig domains, followed by variable numbers of C2-set Ig domains.

940312 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940312 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Carlin AF, Uchiyama S, Chang YC, Lewis AL, Nizet V, Varki A. Molecular mimicry of host sialylated glycans allows a bacterial pathogen to engage neutrophil Siglec-9 and dampen the innate immune response. Blood. 2009; 113(14):3333-3336. (Clone-specific: Functional assay). View Reference
  2. Florian S, Sonneck K, Czerny M, et al. Detection of novel leukocyte differentiation antigens on basophils and mast cells by HLDA8 antibodies. Allergy. 2006; 61(9):1054-1062. (Clone-specific). View Reference
  3. Nguyen DH, Hurtado-Ziola N, Gagneux P, Varki A. Loss of Siglec expression on T lymphocytes during human evolution.. Proc Natl Acad Sci U S A. 2006; 103(20):7765-70. (Clone-specific: Flow cytometry). View Reference
  4. Powell LD, Varki A. I-type lectins. J Biol Chem. 1995; 270(24):14243-14246. (Biology). View Reference
  5. Varki A, Chrispeels MJ. Varki, A., Esko, J. Cummings, R. Ajit Varki .. et al. ; with contributions from Maarten Chrispeels .. et al., ed. Essentials of glycobiology. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; 1999:101.
  6. Zola H, Swart B, Banham A, et al. CD molecules 2006--human cell differentiation molecules.. J Immunol Methods. 2007; 319(1-2):1-5. (Clone-specific: Flow cytometry). View Reference
View All (6) View Less
940312 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.