pAcSecG2T Vector

Complete Sequence: 8641 basepairs
pH promoter 2091->2191
gp67 leader sequence: 2200->2319
GST gene: 2320->3018
Amp(R) 6606->7466
ColE ori: 7637-8225. 

tcgagcagttcgttgacgccttcctccgtgtggccgaacacgtcgagcgggtggtcgatgacca
gcggcgtgccgcacgcgacgcacaagtatctgtacaccgaatgatcgtcgggcgaaggcacgtc
ggcctccaagtggcaatattggcaaattcgaaaatatatacagttgggttgtttgcgcatatct
atcgtggcgttgggcatgtacgtccgaacgttgatttgcatgcaagccgaaattaaatcattgc
gattagtgcgattaaaacgttgtacatcctcgcttttaatcatgccgtcgattaaatcgcgcaa
tcgagtcaagtgatcaaagtgtggaataatgttttctttgtattcccgagtcaagcgcagcgcg
tattttaacaaactagccatcttgtaagttagtttcatttaatgcaactttatccaataatata
ttatgtatcgcacgtcaagaattaacaatgcgcccgttgtcgcatctcaacacgactatgatag
agatcaaataaagcgcgaattaaatagcttgcgacgcaacgtgcacgatctgtgcacgcgttcc
ggcacgagctttgattgtaataagtttttacgaagcgatgacatgacccccgtagtgacaacga
tcacgcccaaaagaactgccgactacaaaattaccgagtatgtcggtgacgttaaaactattaa
gccatccaatcgaccgttagtcgaatcaggaccgctggtgcgagaagccgcgaagtatggcgaa
tgcatcgtataacgtgtggagtccgctcattagagcgtcatgtttagacaagaaagctacatat
ttaattgatcccgatgattttattgataaattgaccctaactccatacacggtattctacaatg
gcggggttttggtcaaaatttccggactgcgattgtacatgctgttaacggctccgcccactat
taatgaaattaaaaattccaattttaaaaaacgcagcaagagaaacatttgtatgaaagaatgc
gtagaaggaaagaaaaatgtcgtcgacatgctgaacaacaagattaatatgcctccgtgtataa
aaaaaatattgaacgatttgaaagaaaacaatgtaccgcgcggcggtatgtacaggaagaggtt
tatactaaactgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatc
aaggctctgacgcatttctacaaccacgactccaagtgtgtgggtgaagtcatgcatcttttaa
tcaaatcccaagatgtgtataaaccaccaaactgccaaaaaatgaaaactgtcgacaagctctg
tccgtttgctggcaactgcaagggtctcaatcctatttgtaattattgaataataaaacaatta
taaatgctaaatttgttttttattaacgatacaaaccaaacgcaacaagaacatttgtagtatt
atctataattgaaaacgcgtagttataatcgctgaggtaatatttaaaatcattttcaaatgat
tcacagttaatttgcgacaatataattttattttcacataaactagacgccttgtcgtcttctt
cttcgtattccttctctttttcatttttctcctcataaaaattaacatagttattatcgtatcc
atatatgtatctatcgtatagagtaaattttttgttgtcataaatatatatgtcttttttaatg
gggtgtatagtaccgctgcgcatagtttttctgtaatttacaacagtgctattttctggtagtt
cttcggagtgtgttgctttaattattaaatttatataatcaatgaatttgggatcgtcggtttt
gtacaatatgttgccggcatagtacgcagcttcttctagttcaattacaccattttttagcagc
accggattaacataactttccaaaatgttgtacgaaccgttaaacaaaaacagttcacctccct
tttctatactattgtctgcgagcagttgtttgttgttaaaaataacagccattgtaatgagacg
cacaaactaatatcacaaactggaaatgtctatcaatatatagttgctgatatcatggagataa
ttaaaatgataaccatctcgcaaataaataagtattttactgttttcgtaacagttttgtaata
aaaaaacctataaatacggatctATGCTACTAGTAAATCAGTCACACCAAGGCTTCAATAAGGA
ACACACAAGCAAGATGGTAAGCGCTATTGTTTTATATGTGCTTTTGGCGGCGGCGGCGCATTCT
GCCTTTGCGGATCTGATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCA
CTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTATGAGCGCGATGAAGG
TGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATCTTCCTTATTATATT
GATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGCTGACAAGCACAACA
TGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGAGCGGTTTTGGATAT
TAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCAAAGTTGATTTTCTT
AGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAAAACATATTTAAATG
GTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTTGTTTTATACATGGA
CCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTATTGAAGCTATCCCA
CAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCAGGGCTGGCAAGCCA
CGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCTGGTTCCGCGTGGATCCCCGGGAATTCA
TCGTGACTGAcgatctgagatccgggttattagtacatttattaagcgctagattctgtgcgtt
gttgatttacagacaattgttgtacgtattttaataattcattaaatttataatctttagggtg
gtatgttagagcgaaaatcaaatgattttcagcgtctttatatctgaatttaaatattaaatcc
tcaatagatttgtaaaataggtttcgattagtttcaaacaagggttgtttttccgaaccgatgg
ctggactatctaatggattttcgctcaacgccacaaaacttgccaaatcttgtagcagcaatct
agctttgtcgatattcgtttgtgttttgttttgtaataaaggttcgacgtcgttcaaaatatta
tgcgcttttgtatttctttcatcactgtcgttagtgtacaattgactcgacgtaaacacgttaa
ataaagcttggacatatttaacatcgggcgtgttagctttattaggccgattatcgtcgtcgtc
ccaaccctcgtcgttagaagttgcttccgaagacgattttgccatagccacacgacgcctatta
attgtgtcggctaacacgtccgcgatcaaatttgtagttgagctttttggaattatttctgatt
gcgggcgtttttgggcgggtttcaatctaactgtgcccgattttaattcagacaacacgttaga
aagcgatggtgcaggcggtggtaacatttcagacggcaaatctactaatggcggcggtggtgga
gctgatgataaatctaccatcggtggaggcgcaggcggggctggcggcggaggcggaggcggag
gtggtggcggtgatgcagacggcggtttaggctcaaatgtctctttaggcaacacagtcggcac
ctcaactattgtactggtttcgggcgccgtttttggtttgaccggtctgagacgagtgcgattt
ttttcgtttctaatagcttccaacaattgttgtctgtcgtctaaaggtgcagcgggttgaggtt
ccgtcggcattggtggagcgggcggcaattcagacatcgatggtggtggtggtggtggaggcgc
tggaatgttaggcacgggagaaggtggtggcggcggtgccgccggtataatttgttctggttta
gtttgttcgcgcacgattgtgggcaccggcgcaggcgccgctggctgcacaacggaaggtcgtc
tgcttcgaggcagcgcttggggtggtggcaattcaatattataattggaatacaaatcgtaaaa
atctgctataagcattgtaatttcgctatcgtttaccgtgccgatatttaacaaccgctcaatg
taagcaattgtattgtaaagagattgtctcaagctcggatcgatcccgcacgccgataacaagc
cttttcatttttactacagcattgtagtggcgagacacttcgctgtcgtcgacgtacatgtatg
ctttgttgtcaaaaacgtcgttggcaagctttaaaatatttaaaagaacatctctgttcagcac
cactgtgttgtcgtaaatgttgtttttgataatttgcgcttccgcagtatcgacacgttcaaaa
aattgatgcgcatcaattttgttgttcctattattgaataaataagattgtacagattcatatc
tacgattcgtcatggccaccacaaatgctacgctgcaaacgctggtacaattttacgaaaactg
caaaaacgtcaaaactcggtataaaataatcaacgggcgctttggcaaaatatctattttatcg
cacaagcccactagcaaattgtatttgcagaaaacaatttcggcgcacaattttaacgctgacg
aaataaaagttcaccagttaatgagcgaccacccaaattttataaaaatctattttaatcacgg
ttccatcaacaaccaagtgatcgtgatggactacattgactgtcccgatttatttgaaacacta
caaattaaaggcgagctttcgtaccaacttgttagcaatattattagacagctgtgtgaagcgc
tcaacgatttgcacaagcacaatttcatacacaacgacataaaactcgaaaatgtcttatattt
cgaagcacttgatcgcgtgtatgtttgcgattacggattgtgcaaacacgaaaactcacttagc
gtgcacgacggcacgttggagtattttagtccggaaaaaattcgacacacaactatgcacgttt
cgtttgactggtacgcggcgtgttaacatacaagttgctaaccggcggccgacacccatttgaa
aaaagcgaagacgaaatgttggacttgaatagcatgaagcgtcgtcagcaatacaatgacattg
gcgttttaaaacacgttcgtaacgttaacgctcgtgactttgtgtactgcctaacaagatacaa
catagattgtagactcacaaattacaaacaaattataaaacatgagtttttgtcgtaaaaatgc
cacttgttttacgagtagaattagcttggcactggccgtcgttttacaacgtcgtgactgggaa
aaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaata
gcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgcct
gatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaaccat
agtacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgc
tacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttc
gccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttac
ggcacctcgaccccaaaaaacttgatttgggtgatggttcacgtagtgggccatcgccctgata
gacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaact
ggaacaacactcaaccctatctcgggctattcttttgatttataagggattttgccgatttcgg
cctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattttaacaaaatattaac
gtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagccc
cgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttaca
gacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacg
cgcgagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtt
tcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttct
aaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattg
aaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattt
tgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgg
gtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccc
cgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgt
attgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagt
actcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgc
cataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggag
ctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagc
tgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgtt
gcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatg
gaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctg
ataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaa
gccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaataga
cagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcat
atatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttt
tgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgta
gaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaa
aaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaa
ggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggc
caccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtgg
ctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataa
ggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctac
accgaactgagatacctacagcgtgagcattgagaaagcgccacgcttcccgaagggagaaagg
cggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccaggggg
aaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttg
tgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcc
tggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataa
ccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgag
tcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccga
ttcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaat
taatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatg
ttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgaat
t