pAcGHLT A Vector

Complete Sequence: 8757 basepairs 
pH promoter: 2091-2191 
GST gene: 2206-3045 
Amp(R): 6722 -> 7582 
ColE ori: 7753-8341

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGG
CCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTAT
GAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATC
TTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGC
TGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGA
GCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCA
AAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAA
AACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTT
GTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTA
TTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCA
GGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCCGATGGGACATCAT
CATCATCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCC
CAGGACTCGATGGCATATGCTCGATCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTG
CAGGGTACCCCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTC
CCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAA
AACACGATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAG
ACAATTGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGC
GAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTG
TAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTA
ATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGAT
ATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTA
TTTCTTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGA
CATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTC
GTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCT
AACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTT
GGGCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGC
AGGCGGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAA
TCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTG
ATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGT
ACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTA
ATAGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTG
GTGGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGG
CACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGC
ACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCA
GCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAG
CATTGTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTA
TTGTAAAGAGATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTT
ACTACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAA
AAACGTCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTC
GTAAATGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCA
TCAATTTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCA
TGGCCACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAA
AACTCGGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACT
AGCAAATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTC
ACCAGTTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAA
CCAAGTGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGC
GAGCTTTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGC
ACAAGCACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGA
TCGCGTGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGC
ACGTTGGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGT
ACGCGGCGTGTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGAC
GAAATGTTGGACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAAC
ACGTTCGTAACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAG
ACTCACAAATTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTAC
GAGTAGAATTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTT
ACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCC
GCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTT
TCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCT
GTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAG
CGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCC
CGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACC
CCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCG
CCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTC
AACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAA
AAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTT
ATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCA
ACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGA
CCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAA
GGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCA
GGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAA
ATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAG
TATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTT
TTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGG
GTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTT
TCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGG
CAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCA
CAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAG
TGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTT
TTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCA
TACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATT
AACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAA
GTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAG
CCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTAT
CGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAG
ATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGA
TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCAT
GACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAA
GGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGC
TACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTT
CAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAG
AACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTG
GCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTC
GGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGA
TACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATC
CGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTA
TCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCA
GGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCT
GGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGC
CTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAG
GAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCA
GCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTA
GCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT
GTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT

pAcGHLT B Vector

Complete Sequence: 8755 basepairs 
pH promoter: 2091-2191 
GST gene: 2206-3087 
Amp(R): 6720->7580 
ColE ori: 7751-8339

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGG
CCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTAT
GAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATC
TTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGC
TGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGA
GCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCA
AAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAA
AACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTT
GTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTA
TTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCA
GGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCCGATGGGACATCAT
CATCATCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCC
CAGGACTCGATGGCATATATGCTCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTGCA
GGGTACCCCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCC
TGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAAAA
CACGATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGAC
AATTGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGA
AAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTGTA
AAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTAAT
GGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATAT
TCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATT
TCTTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGACA
TATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTCGT
TAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCTAA
CACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGG
GCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAG
GCGGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATC
TACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGAT
GCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGTAC
TGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAAT
AGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGT
GGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCA
CGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGCAC
GATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCAGC
GCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCA
TTGTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATT
GTAAAGAGATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTTAC
TACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAA
ACGTCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGT
AAATGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATC
AATTTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATG
GCCACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAA
CTCGGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAG
CAAATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCAC
CAGTTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACC
AAGTGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGA
GCTTTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCAC
AAGCACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATC
GCGTGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCAC
GTTGGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTAC
GCGGCGTGTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGACGA
AATGTTGGACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAACAC
GTTCGTAACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAGAC
TCACAAATTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTACGA
GTAGAATTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC
CCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGC
ACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTC
TCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGT
AGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCG
CCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCG
TCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCC
AAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCC
CTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAA
CCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAA
AATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTAT
GGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAAC
ACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACC
GTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGG
GCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGG
TGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAAT
ATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTA
TGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTT
TGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGT
TACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTC
CAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCA
AGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACA
GAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTG
ATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTT
GCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATA
CCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAA
CTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGT
TGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC
GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCG
TAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGAT
AGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATT
GATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGA
CCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGG
ATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTA
CCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCA
GCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAA
CTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGC
GATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG
GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA
CCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCG
GTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATC
TTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGG
GGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGG
CCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCT
TTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGA
AGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGC
TGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGC
TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGT
GAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT

pAcGHLT C Vector

Complete Sequence: 8753 basepairs 
pH promoter: 2091-2191 
GST gene: 2206-3132 
Amp(R): 6718->7578 
ColE ori: 7749-8337

TCGAGCAGTTCGTTGACGCCTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCA
GCGGCGTGCCGCACGCGACGCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTC
GGCCTCCAAGTGGCAATATTGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCT
ATCGTGGCGTTGGGCATGTACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGC
GATTAGTGCGATTAAAACGTTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAA
TCGAGTCAAGTGATCAAAGTGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCG
TATTTTAACAAACTAGCCATCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATA
TTATGTATCGCACGTCAAGAATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAG
AGATCAAATAAAGCGCGAATTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCC
GGCACGAGCTTTGATTGTAATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGA
TCACGCCCAAAAGAACTGCCGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAA
GCCATCCAATCGACCGTTAGTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAA
TGCATCGTATAACGTGTGGAGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATAT
TTAATTGATCCCGATGATTTTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATG
GCGGGGTTTTGGTCAAAATTTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTAT
TAATGAAATTAAAAATTCCAATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGC
GTAGAAGGAAAGAAAAATGTCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAA
AAAAAATATTGAACGATTTGAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTT
TATACTAAACTGTTACATTGCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATC
AAGGCTCTGACGCATTTCTACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAA
TCAAATCCCAAGATGTGTATAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTG
TCCGTTTGCTGGCAACTGCAAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTA
TAAATGCTAAATTTGTTTTTTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATT
ATCTATAATTGAAAACGCGTAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGAT
TCACAGTTAATTTGCGACAATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTT
CTTCGTATTCCTTCTCTTTTTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCC
ATATATGTATCTATCGTATAGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATG
GGGTGTATAGTACCGCTGCGCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTT
CTTCGGAGTGTGTTGCTTTAATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTT
GTACAATATGTTGCCGGCATAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGC
ACCGGATTAACATAACTTTCCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCT
TTTCTATACTATTGTCTGCGAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACG
CACAAACTAATATCACAAACTGGAAATGTCTATCAATATATAGTTGCTGATATCATGGAGATAA
TTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATA
AAAAAACCTATAAATACGGATCTGTATTCATGTCCCCTATACTAGGTTATTGGAAAATTAAGGG
CCTTGTGCAACCCACTCGACTTCTTTTGGAATATCTTGAAGAAAAATATGAAGAGCATTTGTAT
GAGCGCGATGAAGGTGATAAATGGCGAAACAAAAAGTTTGAATTGGGTTTGGAGTTTCCCAATC
TTCCTTATTATATTGATGGTGATGTTAAATTAACACAGTCTATGGCCATCATACGTTATATAGC
TGACAAGCACAACATGTTGGGTGGTTGTCCAAAAGAGCGTGCAGAGATTTCAATGCTTGAAGGA
GCGGTTTTGGATATTAGATACGGTGTTTCGAGAATTGCATATAGTAAAGACTTTGAAACTCTCA
AAGTTGATTTTCTTAGCAAGCTACCTGAAATGCTGAAAATGTTCGAAGATCGTTTATGTCATAA
AACATATTTAAATGGTGATCATGTAACCCATCCTGACTTCATGTTGTATGACGCTCTTGATGTT
GTTTTATACATGGACCCAATGTGCCTGGATGCGTTCCCAAAATTAGTTTGTTTTAAAAAACGTA
TTGAAGCTATCCCACAAATTGATAAGTACTTGAAATCCAGCAAGTATATAGCATGGCCTTTGCA
GGGCTGGCAAGCCACGTTTGGTGGTGGCGACCATCCTCCAAAATCGGATCCGATGGGACATCAT
CATCATCATCACGGAAGGAGAAGGGCCAGTGTTGCGGCGGGAATTTTGGTCCCTCGTGGAAGCC
CAGGACTCGATGGCATATGCTCGAGGAATTCAGGCCTCCATGGGAGCTCGCGGCCGCCTGCAGG
GTACCCCCGGGAGATCTGTACCGACTCTGCTGAAGAGGAGGAAATTCTCCTTGAAGTTTCCCTG
GTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTGTTCACTGGTCCGGCGTATTAAAACA
CGATACATTGTTATTAGTACATTTATTAAGCGCTAGATTCTGTGCGTTGTTGATTTACAGACAA
TTGTTGTACGTATTTTAATAATTCATTAAATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAA
ATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAATATTAAATCCTCAATAGATTTGTAAA
ATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCGAACCGATGGCTGGACTATCTAATGG
ATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAGCAGCAATCTAGCTTTGTCGATATTC
GTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTCAAAATATTATGCGCTTTTGTATTTC
TTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAAACACGTTAAATAAAGCTTGGACATA
TTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATCGTCGTCGTCCCAACCCTCGTCGTTA
GAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGACGCCTATTAATTGTGTCGGCTAACA
CGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGC
GGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAACACGTTAGAAAGCGATGGTGCAGGC
GGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGCGGTGGTGGAGCTGATGATAAATCTA
CCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGATGC
AGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACACAGTCGGCACCTCAACTATTGTACTG
GTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAG
CTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGG
AGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACG
GGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGTTCTGGTTTAGTTTGTTCGCGCACGA
TTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGGAAGGTCGTCTGCTTCGAGGCAGCGC
TTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAAATCGTAAAAATCTGCTATAAGCATT
GTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAACCGCTCAATGTAAGCAATTGTATTGT
AAAGAGATTGTCTCAAGCTCGGATCGATCCCGCACGCCGATAACAAGCCTTTTCATTTTTACTA
CAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGCTTTGTTGTCAAAAAC
GTCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACCACTGTGTTGTCGTAA
ATGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAAATTGATGCGCATCAA
TTTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCTACGATTCGTCATGGC
CACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGCAAAAACGTCAAAACT
CGGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGCACAAGCCCACTAGCA
AATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGAAATAAAAGTTCACCA
GTTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGTTCCATCAACAACCAA
GTGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTACAAATTAAAGGCGAGC
TTTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCTCAACGATTTGCACAA
GCACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTCGAAGCACTTGATCGC
GTGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCGTGCACGACGGCACGT
TGGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTCGTTTGACTGGTACGC
GGCGTGTTAACATACAAGTTGCTAACCGGCGGCCGACACCCATTTGAAAAAAGCGAAGACGAAA
TGTTGGACTTGAATAGCATGAAGCGTCGTCAGCAATACAATGACATTGGCGTTTTAAAACACGT
TCGTAACGTTAACGCTCGTGACTTTGTGTACTGCCTAACAAGATACAACATAGATTGTAGACTC
ACAAATTACAAACAAATTATAAAACATGAGTTTTTGTCGTAAAAATGCCACTTGTTTTACGAGT
AGAATTAGCTTGGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCC
AACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCAC
CGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTC
CTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAG
CGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCC
CTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTC
AAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAA
AAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCT
TTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACC
CTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAA
TGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGG
TGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACAC
CCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGT
CTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGAGACGAAAGGGC
CTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTG
GCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATAT
GTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATG
AGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTG
CTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTA
CATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCA
ATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAG
AGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGA
AAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGAT
AACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGC
ACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACC
AAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACT
GGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTG
CAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGG
TGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTA
GTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAG
GTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGA
TTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACC
AAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGAT
CTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACC
AGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGC
AGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACT
CTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGA
TAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGC
TGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACC
TACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGT
AAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTT
TATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGG
GGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCC
TTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTT
GAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAG
CGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTG
GCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTC
ACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGA
GCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATT