Skip to main content Skip to navigation
Oligo Mouse Anti-Human Siglec-1 (CD169)

BD™ AbSeq Oligo Mouse Anti-Human Siglec-1 (CD169)

Clone 7-239

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Sialoadhesin; SN; SIGLEC1; Siglec-1; Sialic acid-binding Ig-like lectin 1
6614
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATTAAGCACGAAGGGTATAGGTAGGAACGGTTGGC
AHS0133
Human Rhinovirus-infected Dendritic Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940223 Rev. 2
Antibody Details
Down Arrow Up Arrow
7-239

The 7-239 monoclonal antibody specifically binds to Sialic acid-binding Ig-like lectin 1 (Siglec-1), which is also known as Sialoadhesin (SN), or CD169.  Siglec-1 is a type I transmembrane glycoprotein that belongs to the Siglec family within the Ig superfamily. This adhesion molecule especially binds to glycolipids and glycoproteins with terminal α-2 sialyl residues. Siglec-1 is expressed by macrophages and dendritic cells and serves as a cellular interaction molecule. Its expression can be upregulated by cells in response to type II collagen, or to cytokines including interferons, and tumor necrosis factor. Siglec-1 plays roles in endocytosis, hematopoiesis, and leucocyte migration. It mediates macrophage binding to various cell types including developing and mature leucocytes. Siglec-1 that is expressed by dendritic cells can also bind HIV-1 and may mediate viral transfer to bystander CD4+ T cells. Several Siglec-1 counter-receptors have been described including CD43, CD206, and CD227 which are expressed by T cells, macrophages, or breast cancer cells, respectively. The 7-239 antibody reportedly blocks Siglec-1 functions in some cellular assay systems.

940223 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940223 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Hartnell A, Steel J, Turley H, Jones M, Jackson DG, Crocker PR. Characterization of human sialoadhesin, a sialic acid binding receptor expressed by resident and inflammatory macrophage populations. Blood. 2001; 97(1):288-296. (Biology). View Reference
  2. Izquierdo-Useros N, Lorizate M, Puertas MC, et al. Siglec-1 is a novel dendritic cell receptor that mediates HIV-1 trans-infection through recognition of viral membrane gangliosides. PLoS ONE. 10(12)(Biology). View Reference
  3. Kirchberger S, Majdic O, Steinberger P, et al. Human rhinoviruses inhibit the accessory function of dendritic cells by inducing sialoadhesin and B7-H1 expression. J Immunol. 2005; 175(2):1145-1152. (Immunogen: Blocking, Cell separation, Flow cytometry, Functional assay, Inhibition, Western blot). View Reference
  4. Rose T, Grützkau A, Hirseland H, et al. IFNα and its response proteins, IP-10 and SIGLEC-1, are biomarkers of disease activity in systemic lupus rythematosus. Arthritis Rheum. 2013; 72(10):1639-1645. (Biology). View Reference
  5. Xiong YS, Cheng Y, Lin QS, et al. Increased expression of Siglec-1 on peripheral blood monocytes and its role in mononuclear cell reactivity to autoantigen in rheumatoid arthritis. Rheumatology (Oxford). (Biology). View Reference
  6. van den Berg TK, Nath D, Ziltener HJ, et al. Cutting edge: CD43 functions as a T cell counterreceptor for the macrophage adhesion eceptor sialoadhesin Siglec-1) . J Immunol. 2001; 166(6):3637-3640. (Biology). View Reference
View All (6) View Less
940223 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.

Refer to manufacturer's instructions for use and related User Manuals and Technical Data Sheets before using this product as described.

Comparisons, where applicable, are made against older BD technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.