Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD8a

BD™ AbSeq Oligo Rat Anti-Mouse CD8a

Clone 53-6.7

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd8a; CD8 alpha chain; Ly-2; Lyt2; Lyt-2; Ly-35; Ly-B
12525
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CACAAGGGTCGTAATATAGGTAACAGTAGTAGGCCG
AMM2142
Mouse Spleen Cells or Thymocyte Membranes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940345 Rev. 2
Antibody Details
Down Arrow Up Arrow
53-6.7

The 53-6.7 monoclonal antibody specifically binds to the 38 kDa α and 34 kDa α' chains of the CD8 differentiation antigen (Ly-2 or Lyt-2) of all mouse strains tested. The CD8 α and α' chains (CD8a) form heterodimers with the CD8 β chain (CD8b, Ly-3, or Lyt-3) on the surface of most thymocytes. A subpopulation of mature T lymphocytes (i.e., MHC class I-restricted T cells, including most T suppressor/cytotoxic cells) expresses almost exclusively the CD8 αβ heterodimer. Subsets of γδ TCR-bearing T cells, intestinal intrapithelial lymphocytes, and dendritic cells express CD8a without CD8b. It has been suggested that the expression of the CD8a/CD8b heterodimer is restricted to T lymphocytes which matured in the thymus or in an extrathymic environment that had been influenced by thymus-initiated neuroendocrine signals. CD8 is an antigen coreceptor on the T-cell surface which interacts with MHC class I molecules on antigen-presenting cells or epithelial cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck (p56 [lck]). The CD8 α and α' chains arise from alternatively spliced messengers of a single CD8a gene. The longer α form associates with p56 [lck] via a CXCP motif in its cytoplasmic domain, which it shares with CD4, but not with CD8b. The truncated α' chain is unable to associate with p56 [lck], and it may function to attenuate the CD8-mediated costimulatory signal during intrathymic T-cell maturation.  In vivo and in vitro treatment with 53-6.7 mAb has reportedly been effective at depleting CD8+ peripheral T lymphocytes. The 53-6.7 antibody has also been reported to cross-react with CD8 α- and α'-like polypeptides on subsets of thymic and peripheral lymphocytes in the Egyptian toad, Bufo regularis.

940345 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940345 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (15)

  1. Fujiura Y, Kawaguchi M, Kondo Y, et al. Development of CD8 alpha alpha+ intestinal intraepithelial T cells in beta 2-microglobulin- and/or TAP1-deficient mice. J Immunol. 1996; 156(8):2710-2715. (Clone-specific: Flow cytometry). View Reference
  2. Hathcock KS. T cell depletion by cytotoxic elimination. Curr Protoc Immunol. 1991; 1:3.4.1-3.4.3. (Clone-specific: Cell separation, Depletion, Flow cytometry). View Reference
  3. Kruisbeek AM, Shevach EM. Proliferative assays for T cell function. Curr Protoc Immunol. 2004; 3:3.12.1-3.12.14. (Clone-specific: Depletion, In vivo exacerbation). View Reference
  4. Ledbetter JA, Herzenberg LA. Xenogeneic monoclonal antibodies to mouse lymphoid differentiation antigens. Immunol Rev. 1979; 47:63-90. (Immunogen: Flow cytometry, Immunofluorescence, Immunoprecipitation). View Reference
  5. Ledbetter JA, Rouse RV, Micklem HS, Herzenberg LA. T cell subsets defined by expression of Lyt-1,2,3 and Thy-1 antigens. Two-parameter immunofluorescence and cytotoxicity analysis with monoclonal antibodies modifies current views. J Exp Med. 1980; 152(2):280-295. (Immunogen: Flow cytometry). View Reference
  6. Ledbetter JA, Seaman WE, Tsu TT, Herzenberg LA. Lyt-2 and lyt-3 antigens are on two different polypeptide subunits linked by disulfide bonds. Relationship of subunits to T cell cytolytic activity. J Exp Med. 1981; 153(6):1503-1516. (Clone-specific: Blocking, Flow cytometry, Immunoprecipitation, Inhibition). View Reference
  7. Leishman AJ, Naidenko OV, Attinger A, et al. T cell responses modulated through interaction between CD8alphaalpha and the nonclassical MHC class I molecule, TL. Science. 2001; 294(5548):1848-1849. (Clone-specific: Blocking, Flow cytometry). View Reference
  8. MacDonald HR, Schreyer M, Howe RC, Bron C. Selective expression of CD8 alpha (Ly-2) subunit on activated thymic gamma/delta cells. Eur J Immunol. 1990; 20(4):927-930. (Biology). View Reference
  9. Nakayama K, Nakayama K, Negishi I, et al. Requirement for CD8 beta chain in positive selection of CD8-lineage T cells. Science. 1994; 263(5150):1131-1133. (Biology). View Reference
  10. Sydora BC, Brossay L, Hagenbaugh A, Kronenberg M, Cheroutre H. TAP-independent selection of CD8+ intestinal intraepithelial lymphocytes. J Immunol. 1996; 156(11):4209-4216. (Clone-specific: Flow cytometry). View Reference
  11. Takahashi K, Nakata M, Tanaka T, et al. CD4 and CD8 regulate interleukin 2 responses of T cells. Proc Natl Acad Sci U S A. 1992; 89(12):5557-5561. (Clone-specific: Immunoprecipitation, Inhibition). View Reference
  12. Vremec D, Zorbas M, Scollay R, et al. The surface phenotype of dendritic cells purified from mouse thymus and spleen: investigation of the CD8 expression by a subpopulation of dendritic cells. J Exp Med. 1992; 176(1):47-58. (Clone-specific: Flow cytometry). View Reference
  13. Wang J, Klein JR. Thymus-neuroendocrine interactions in extrathymic T cell development. Science. 1994; 265(5180):1860-1862. (Biology). View Reference
  14. Wu L, Vremec D, Ardavin C, et al. Mouse thymus dendritic cells: kinetics of development and changes in surface markers during maturation. Eur J Immunol. 1995; 25(2):418-425. (Biology). View Reference
  15. van Ewijk W, van Soest PL, van den Engh GJ. Fluorescence analysis and anatomic distribution of mouse T lymphocyte subsets defined by monoclonal antibodies to the antigens Thy-1, Lyt-1, Lyt-2, and T-200. J Immunol. 1981; 127(6):2594-2604. (Clone-specific: Flow cytometry, Immunofluorescence, Immunohistochemistry). View Reference
View All (15) View Less
940345 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.