Skip to main content Skip to navigation
Oligo Rat Anti-Mouse NKG2A/C/E

Oligo Rat Anti-Mouse NKG2A/C/E

Clone 20d5

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
NKG2A/NKG2C/NKG2E; Klrc1/Klrc2/Klrc3; CD159a/CD159c/CD159e; CD159
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTGTAAACGTATTGGTGCGCTATGAGTCAGATGGC
AMM2220
Mouse CD94 and NKG2A Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Please refer to bd.com/genomics-resources for technical protocols.
940444 Rev. 1
Antibody Details
Down Arrow Up Arrow
20d5

The 20d5 monoclonal antibody specifically recognizes NKG2A, NKG2C, and NKG2E (also known as CD159a, CD159c, and CD159e which are encoded by Klrc1, Klrc2, and Klrc3, respectively) on a subset of NK and NK-T cells in most strains tested (eg, AKR/J, BALB/c, C3H/He, C57BL/6, CBA/J, DBA/1, FVB/N, 129/Sv, NOD, SWR, and most DBA/2 substrains, but not DBA/2J). The NKG2 molecules are a family of lectin-like receptors that form heterodimers with CD94 on the surface of NK cells.  DBA/2J mice do not express CD94, and the lack of CD94 is responsible for the absence of NKG2 expression in this substrain.  NKG2 receptors are also expressed on CD8+ T lymphocytes activated in vivo and in vitro.  The heterodimers of CD94 with NKG2A, C, or E recognize Qa-1, a nonclassical MHC class I antigen, presenting the Qdm peptide.  Studies of CD94/NKG2 heterodimers on human NK cells have demonstrated that the NKG2 components mediate signal transduction for the receptor, with NKG2A being inhibitory and NKG2C being stimulatory. The CD94/NKG2E heterodimer is also thought to be stimulatory.  The mouse NKG2A molecule contains two intracytoplasmic sequences that resemble the ITIM (Immunoreceptor Tyrosine- based Inhibitory Motif) consensus sequence.  NKG2A transcripts have been shown to be up to 20-fold more abundant than NKG2C and NKG2E mRNA in NK cells of adult mice.  The CD94/NKG2 receptors show increased expression on neonatal NK cells compared to the Ly-49 MHC class I receptors, suggesting that CD94/NKG2 receptors and their ligand, Qa-1, may play a role in maintenance of self-tolerance in developing NK cells.  The 20d5 antibody is useful for identification of NK cells expressing functional CD94/NKG2 receptors, in contrast to the non-functional CD94 expressed alone, and it blocks the binding of Qdm-complexed Qa-1b tetramers to CD94/NKG2-transfected CHO cells.  

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940444 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940444 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Kubota A, Kubota S, Lohwasser S, Mager DL, Takei F. Diversity of NK cell receptor repertoire in adult and neonatal mice. Eur J Immunol. 1999; 163(1):212-216. (Biology). View Reference
  2. Lohwasser S, Hande P, Mager DL, Takei F. Cloning of murine NKG2A, B and C: second family of C-type lectin receptors on murine NK cells. Eur J Immunol. 1999; 29(3):755-761. (Biology). View Reference
  3. McMahon CW, Zajac AJ, Jamieson AM. Viral and bacterial infections induce expression of multiple NK cell receptors in responding CD8(+) T cells. J Immunol. 2002; 169(3):1444-1452. (Clone-specific: Flow cytometry). View Reference
  4. Vance RE, Jamieson AM, Cado D, Raulet DH. Implications of CD94 deficiency and monoallelic NKG2A expression for natural killer cell development and repertoire formation. Proc Natl Acad Sci U S A. 2002; 99(2):868-873. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  5. Vance RE, Jamieson AM, Raulet DH. Recognition of the class Ib molecule Qa-1(b) by putative activating receptors CD94/NKG2C and CD94/NKG2E on mouse natural killer cells. J Exp Med. 1999; 190(12):1801-1812. (Immunogen: ELISA, Flow cytometry). View Reference
  6. Vance RE, Kraft JR, Altman JD, Jensen PE, Raulet DH. Mouse CD94/NKG2A is a natural killer cell receptor for the nonclassical major histocompatibility complex (MHC) class I molecule Qa-1(b). J Exp Med. 1998; 188(10):1841-1848. (Biology). View Reference
  7. Yokoyama WM. Natural killer cell receptors. Curr Opin Immunol. 1998; 10(3):298-305. (Biology). View Reference
View All (7) View Less
940444 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.