Skip to main content Skip to navigation
Oligo Mouse Anti-Human HLA-ABC

BD™ AbSeq Oligo Mouse Anti-Human HLA-ABC

Clone G46-2.6

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Major histocompatibility complex, class I, A,B,C; HLA class I A,B,C
3105, 3106, 3107
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATATGCATGGCGAGTAGGTAGAACGAAGCTTAGGT
AHS0066
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940062 Rev. 3
Antibody Details
Down Arrow Up Arrow
G46-2.6

The Human Leukocyte Antigen (HLA) complex is the human version of the MHC, helping the immune system distinguish the body's own proteins versus those from foreign invaders, such as viruses.  Humans have three main MHC class I genes, known as HLA-A, HLA-B and HLA-C.  Major histocompatibility complex (MHC) class I molecules, which are widely found on the surface of nucleated cells, function by binding peptides and displaying them on the cell surface to cytotoxic T-cells.  Intracellular degradation of cytosolic proteins by the proteasome generates many of the peptides that load MHC class I molecules.  MHC class I may also serve as an inhibitory ligand for natural killer (NK) cell receptors (KIR, Killer Immunoglobulin-like Receptors), which viruses may modulate expression levels for to evade immune detection.  The G46-2.6 monoclonal antibody binds to a monomorphic epitope on the alpha chain of HLA-A, HLA-B and HLA-C.

940062 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940062 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Crisa L, Cirulli V, Ellisman MH, Ishii JK, Elices MJ, Salomon DR. Cell adhesion and migration are regulated at distinct stages of thymic T cell development: the roles of fibronectin, VLA4, and VLA5. J Exp Med. 1996; 184(1):215-228. (Clone-specific: Flow cytometry). View Reference
  3. Kap YS, van Meurs M, van Driel N, et al. A monoclonal antibody selection for immunohistochemical examination of lymphoid tissues from non-human primates. J Histochem Cytochem. 2009; 57(12):1159-1167. (Clone-specific: Immunohistochemistry). View Reference
  4. Koppelman B, Neefjes JJ, de Vries JE, de Waal Malefyt R. Interleukin-10 down-regulates MHC class II alphabeta peptide complexes at the plasma membrane of monocytes by affecting arrival and recycling. Immunity. 1997; (6):861-871. (Clone-specific: Flow cytometry). View Reference
  5. Xia H, Liu H, Zhang G, Zheng Y. Phenotype and function of monocyte-derived dendritic cells from chinese rhesus macaques. Cell Mol Immunol. 2009; 6(3):159-165. (Clone-specific: Flow cytometry). View Reference
940062 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.