Vector Sequences

pAcMP 2 Vector

Complete Sequence: 9847 basepairs
basic protein promoter: 4242 -> 4340
Amp(R): 8389 - 9248
ColE ori: 7629 - 8217

AAGCTTTACTCGTAAAGCGAGTTGAAGGATCATATTTAGTTGCGTTTATGAGATAAGATTGAAA
GCACGTGTAAAATGTTTCCCGCGCGTTGGCACAACTATTTACAATGCGGCCAAGTTATAAAAGA
TTCTAATCTGATATGTTTTAAAACACCTTTGCGGCCCGAGTTGTTTGCGTACGTGACTAGCGAA
GAAGATGTGTGGACCGCAGAACAGATAGTAAAACAAAACCCTAGTATTGGAGCAATAATCGATT
TAACCAACACGTCTAAATATTATGATGGTGTGCATTTTTTGCGGGCGGGCCTGTTATACAAAAA
AATTCAAGTACCTGGCCAGACTTTGCCGCCTGAAAGCATAGTTCAAGAATTTATTGACACGGTA
AAAGAATTTACAGAAAAGTGTCCCGGCATGTTGGTGGGCGTGCACTGCACACACGGTATTAATC
GCACCGGTTACATGGTGTGCAGATATTTAATGCACACCCTGGGTATTGCGCCGCAGGAAGCCAT
AGATAGATTCGAAAAAGCCAGAGGTCACAAAATTGAAAGACAAAATTACGTTCAAGATTTATTA
ATTTAATTAATATTATTTGCATTCTTTAACAAATACTTTATCCTATTTTCAAATTGTTGCGCTT
CTTCCAGCGAACCAAAACTATGCTTCGCTTGCTCCGTTTAGCTTGTAGCCGATCAGTGGCGTTG
TTCCAATCGACGGTAGGATTAGGCCGGATATTCTCCACCACAATGTTGGCAACGTTGATGTTAC
GTTTATGCTTTTGGTTTTCCACGTACGTCTTTTGGCCGGTAATAGCCGTAAACGTAGTGCCGTC
GCGCGTCACGCACAACACCGGATGTTTGCGCTTGTCCGCGGGGTATTGAACCGCGCGATCCGAC
AAATCCACCACTTTGGCAACTAAATCGGTGACCTGCGCGTCTTTTTTCTGCATTATTTCGTCTT
TCTTTTGCATGGTTTCCTGGAAGCCGGTGTACATGCGGTTTAGATCAGTCATGACGCGCGTGAC
CTGCAAATCTTTGGCCTCGATCTGCTTGTCCTTGATGGCAACGATGCGTTCAATAAACTCTTGT
TTTTTAACAAGTTCCTCGGTTTTTTGCGCCACCACCGCTTGCAGCGCGTTTGTGTGCTCGGTGA
ATGTCGCAATCAGCTTAGTCACCAACTGTTTGCTCTCCTCCTCCCGTTGTTTGATCGCGGGATC
GTACTTGCCGGTGCAGAGCACTTGAGGAATTACTTCTTCTAAAAGCCATTCTTGTAATTCTATG
GCGTAAGGCAATTTGGACTTCATAATCAGCTGAATCACGCCGGATTTAGTAATGAGCACTGTAT
GCGGCTGCAAATACAGCGGGTCGCCCCTTTTCACGACGCTGTTAGAGGTAGGGCCCCCATTTTG
GATGGTCTGCTCAAATAACGATTTGTATTTATTGTCTACATGAACACGTATAGCTTTATCACAA
ACTGTATATTTTAAACTGTTAGCGACGTCCTTGGCCACGAACCGGACCTGTTGGTCGCGCTCTA
GCACGTACCGCAGGTTGAACGTATCTTCTCCAAATTTAAATTCTCCAATTTTAACGCGAGCCAT
TTTGATACACGTGTGTCGATTTTGCAACAACTATTGTTTTTTAACGCAAACTAAACTTATTGTG
GTAAGCAATAATTAAATATGGGGGAACATGCGCCGCTACAACACTCGTCGTTATGAACGCAGAC
GGCGCCGGTCTCGGCGCAAGCGGCTAAAACGTGTTGCGCGTTCAACGCGGCAAACATCGCAAAA
GCCAATAGTACAGTTTTGATTTGCATATTAACGGCGATTTTTTAAATTATCTTATTTAATAAAT
AGTTATGACGCCTACAACTCCCCGCCCGCGTTGACTCGCTGCACCTCGAGCAGTTCGTTGACGC
CTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCAGCGGCGTGCCGCACGCGAC
GCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTCGGCCTCCAAGTGGCAATAT
TGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCTATCGTGGCGTTGGGCATGT
ACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGCGATTAGTGCGATTAAAACG
TTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAATCGAGTCAAGTGATCAAAG
TGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCGTATTTTAACAAACTAGCCA
TCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATATTATGTATCGCACGTCAAG
AATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAGAGATCAAATAAAGCGCGAA
TTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCCGGCACGAGCTTTGATTGTA
ATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGATCACGCCCAAAAGAACTGC
CGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAAGCCATCCAATCGACCGTTA
GTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGG
AGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCCGATGATT
TTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATGGCGGGGTTTTGGTCAAAAT
TTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCC
AATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAGAAAAATG
TCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAACGATTT
GAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATT
GCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCT
ACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTA
TAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGC
AAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTTGTTTT
TTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCG
TAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACA
ATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTT
TTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCCATATATGTATCTATCGTAT
AGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACCGCTGC
GCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTT
AATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCA
TAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGCACCGGATTAACATAACTTT
CCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGC
GAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAA
CTGGAAATGTCTATCAATATATAGTTGCTGATCAGATCCCCGGGTACCAAATTCCGTTTTGCGA
CGATGCAGAGTTTTTGAACAGGCTGCTCAAACACATAGATCCGTACCCGCTCAGTCGGATGTAT
TACAATGCAGCCAATACCATGTTTTACACGACTATGGAAAACTATGCCGTGTCCAATTGCAAGT
TCAACATTGAGGATTACAATAACATATTTAAGGTGATGGAAAATATTAGGAAACACAGCAACAA
AAATTCAAACGACCAAGACGAGTTAAACATATATTTGGGAGTTCAGTCGTCGAATGCAAAGCGT
AAAAAATATTAATAAGGTAAAAATTACAGCTACATAAATTACACAATTTAAACGGATCTGCAGC
GGCCGCTCCAGAATTCTAGAAGGTACCCGGGATCCTTTCCTGGGACCCGGCAAGAACCAAAAAC
TCACTCTCTTCAAGGAAATCCGTAATGTTAAACCCGACACGATGAAGCTTGTCGTTGGATGGAA
AGGAAAAGAGTTCTACAGGGAAACTTGGACCCGCTTCATGGAAGACAGCTTCCCCATTGTTAAC
GACCAAGAAGTGATGGATGTTTTCCTTGTTGTCAACATGCGTCCCACTAGACCCAACCGTTGTT
ACAAATTCCTGGCCCAACACGCTCTGCGTTGCGACCCCGACTATGTACCTCATGACGTGATTAG
GATCGTCGAGCCTTCATGGGTGGGCAGCAACAACGAGTACCGCATCAGCCTGGCTAAGAAGGGC
GGCGGCTGCCCAATAATGAACCTTCACTCTGAGTACACCAACTCGTTCGAACAGTTCATCGATC
GTGTCATCTGGGAGAACTTCTACAAGCCCATCGTTTACATCGGTACCGACTCTGCTGAAGAGGA
GGAAATTCTCCTTGAAGTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCACCTCTG
TTCACTGGTCCGGCGTATTAAAACACGATACATTGTTATTAGTACATTTATTAAGCGCTAGATT
CTGTGCGTTGTTGATTTACAGACAATTGTTGTACGTATTTTAATAATTCATTAAATTTATAATC
TTTAGGGTGGTATGTTAGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATTTAAAT
ATTAAATCCTCAATAGATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTTTTCCG
AACCGATGGCTGGACTATCTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCTTGTAG
CAGCAATCTAGCTTTGTCGATATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGTCGTTC
AAAATATTATGCGCTTTTGTATTTCTTTCATCACTGTCGTTAGTGTACAATTGACTCGACGTAA
ACACGTTAAATAAAGCTTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGATTATC
GTCGTCGTCCCAACCCTCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCACACGA
CGCCTATTAATTGTGTCGGCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGGAATTA
TTTCTGATTGCGGGCGTTTTTGGGCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCAGACAA
CACGTTAGAAAGCGATGGTGCAGGCGGTGGTAACATTTCAGACGGCAAATCTACTAATGGCGGC
GGTGGTGGAGCTGATGATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGGAGGCG
GAGGCGGAGGTGGTGGCGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGCAACAC
AGTCGGCACCTCAACTATTGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGAGACGA
GTGCGATTTTTTTCGTTTCTAATAGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGCAGCGG
GTTGAGGTTCCGTCGGCATTGGTGGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGTGGTGG
TGGAGGCGCTGGAATGTTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAATTTGT
TCTGGTTTAGTTTGTTCGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCACAACGG
AAGGTCGTCTGCTTCGAGGCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAATACAA
ATCGTAAAAATCTGCTATAAGCATTGTAATTTCGCTATCGTTTACCGTGCCGATATTTAACAAC
CGCTCAATGTAAGCAATTGTATTGTAAAGAGATTGTCTCAAGCTCCGCACGCCGATAACAAGCC
TTTTCATTTTTACTACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATGTATGC
TTTGTTGTCAAAAACGTCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCAGCACC
ACTGTGTTGTCGTAAATGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTCAAAAA
ATTGATGCGCATCAATTTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCATATCT
ACGATTCGTCATGGCCACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAAACTGC
AAAAACGTCAAAACTCGGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTTATCGC
ACAAGCCCACTAGCAAATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCTGACGA
AATAAAAGTTCACCAGTTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATCACGGT
TCCATCAACAACCAAGTGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAACACTAC
AAATTAAAGGCGAGCTTTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAAGCGCT
CAACGATTTGCACAAGCACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTATATTTC
GAAGCACTTGATCGCGTGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACTTAGCG
TGCACGACGGCACGTTGGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCACGTTTC
GTTTGACTGGTACGCGGCGTGTTAACATACAAGTTGCTAACCGGcggttcGTAATCATGGTCAT
AGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCAT
AAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTG
CCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGA
GAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGT
TCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGG
GATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCG
CGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAG
TCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTC
GTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAA
GCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAA
GCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGT
CTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTA
GCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACAC
TAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGT
AGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGA
TTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCA
GTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAG
ATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG
ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT
AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGT
GCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAG
CCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTG
TTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCT
ACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGAT
CAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT
CGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT
CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCT
GAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCC
ACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGG
ATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCAT
CTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGG
AATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATT
TATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG
GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGAC
ATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGT
GAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGA
GCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC
GGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTA
AGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGAT
CGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG
TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC

pAcMP 3 Vector

Complete Sequence: 9852 basepairs
basic protein promoter: 4242 -> 4340;
Amp(R) 8384 - 9243
ColE ori 7624 - 8212

AAGCTTTACTCGTAAAGCGAGTTGAAGGATCATATTTAGTTGCGTTTATGAGATAAGATTGAAA
GCACGTGTAAAATGTTTCCCGCGCGTTGGCACAACTATTTACAATGCGGCCAAGTTATAAAAGA
TTCTAATCTGATATGTTTTAAAACACCTTTGCGGCCCGAGTTGTTTGCGTACGTGACTAGCGAA
GAAGATGTGTGGACCGCAGAACAGATAGTAAAACAAAACCCTAGTATTGGAGCAATAATCGATT
TAACCAACACGTCTAAATATTATGATGGTGTGCATTTTTTGCGGGCGGGCCTGTTATACAAAAA
AATTCAAGTACCTGGCCAGACTTTGCCGCCTGAAAGCATAGTTCAAGAATTTATTGACACGGTA
AAAGAATTTACAGAAAAGTGTCCCGGCATGTTGGTGGGCGTGCACTGCACACACGGTATTAATC
GCACCGGTTACATGGTGTGCAGATATTTAATGCACACCCTGGGTATTGCGCCGCAGGAAGCCAT
AGATAGATTCGAAAAAGCCAGAGGTCACAAAATTGAAAGACAAAATTACGTTCAAGATTTATTA
ATTTAATTAATATTATTTGCATTCTTTAACAAATACTTTATCCTATTTTCAAATTGTTGCGCTT
CTTCCAGCGAACCAAAACTATGCTTCGCTTGCTCCGTTTAGCTTGTAGCCGATCAGTGGCGTTG
TTCCAATCGACGGTAGGATTAGGCCGGATATTCTCCACCACAATGTTGGCAACGTTGATGTTAC
GTTTATGCTTTTGGTTTTCCACGTACGTCTTTTGGCCGGTAATAGCCGTAAACGTAGTGCCGTC
GCGCGTCACGCACAACACCGGATGTTTGCGCTTGTCCGCGGGGTATTGAACCGCGCGATCCGAC
AAATCCACCACTTTGGCAACTAAATCGGTGACCTGCGCGTCTTTTTTCTGCATTATTTCGTCTT
TCTTTTGCATGGTTTCCTGGAAGCCGGTGTACATGCGGTTTAGATCAGTCATGACGCGCGTGAC
CTGCAAATCTTTGGCCTCGATCTGCTTGTCCTTGATGGCAACGATGCGTTCAATAAACTCTTGT
TTTTTAACAAGTTCCTCGGTTTTTTGCGCCACCACCGCTTGCAGCGCGTTTGTGTGCTCGGTGA
ATGTCGCAATCAGCTTAGTCACCAACTGTTTGCTCTCCTCCTCCCGTTGTTTGATCGCGGGATC
GTACTTGCCGGTGCAGAGCACTTGAGGAATTACTTCTTCTAAAAGCCATTCTTGTAATTCTATG
GCGTAAGGCAATTTGGACTTCATAATCAGCTGAATCACGCCGGATTTAGTAATGAGCACTGTAT
GCGGCTGCAAATACAGCGGGTCGCCCCTTTTCACGACGCTGTTAGAGGTAGGGCCCCCATTTTG
GATGGTCTGCTCAAATAACGATTTGTATTTATTGTCTACATGAACACGTATAGCTTTATCACAA
ACTGTATATTTTAAACTGTTAGCGACGTCCTTGGCCACGAACCGGACCTGTTGGTCGCGCTCTA
GCACGTACCGCAGGTTGAACGTATCTTCTCCAAATTTAAATTCTCCAATTTTAACGCGAGCCAT
TTTGATACACGTGTGTCGATTTTGCAACAACTATTGTTTTTTAACGCAAACTAAACTTATTGTG
GTAAGCAATAATTAAATATGGGGGAACATGCGCCGCTACAACACTCGTCGTTATGAACGCAGAC
GGCGCCGGTCTCGGCGCAAGCGGCTAAAACGTGTTGCGCGTTCAACGCGGCAAACATCGCAAAA
GCCAATAGTACAGTTTTGATTTGCATATTAACGGCGATTTTTTAAATTATCTTATTTAATAAAT
AGTTATGACGCCTACAACTCCCCGCCCGCGTTGACTCGCTGCACCTCGAGCAGTTCGTTGACGC
CTTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCAGCGGCGTGCCGCACGCGAC
GCACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTCGGCCTCCAAGTGGCAATAT
TGGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCTATCGTGGCGTTGGGCATGT
ACGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGCGATTAGTGCGATTAAAACG
TTGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAATCGAGTCAAGTGATCAAAG
TGTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCGTATTTTAACAAACTAGCCA
TCTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATATTATGTATCGCACGTCAAG
AATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAGAGATCAAATAAAGCGCGAA
TTAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCCGGCACGAGCTTTGATTGTA
ATAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGATCACGCCCAAAAGAACTGC
CGACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAAGCCATCCAATCGACCGTTA
GTCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGG
AGTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCCGATGATT
TTATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATGGCGGGGTTTTGGTCAAAAT
TTCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCC
AATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAGAAAAATG
TCGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAACGATTT
GAAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATT
GCAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCT
ACAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTA
TAAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGC
AAGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTTGTTTT
TTATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCG
TAGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACA
ATATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTT
TTCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCCATATATGTATCTATCGTAT
AGAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACCGCTGC
GCATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTT
AATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCA
TAGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGCACCGGATTAACATAACTTT
CCAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGC
GAGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAA
CTGGAAATGTCTATCAATATATAGTTGCTGATCAGATCCCCGGGTACCAAATTCCGTTTTGCGA
CGATGCAGAGTTTTTGAACAGGCTGCTCAAACACATAGATCCGTACCCGCTCAGTCGGATGTAT
TACAATGCAGCCAATACCATGTTTTACACGACTATGGAAAACTATGCCGTGTCCAATTGCAAGT
TCAACATTGAGGATTACAATAACATATTTAAGGTGATGGAAAATATTAGGAAACACAGCAACAA
AAATTCAAACGACCAAGACGAGTTAAACATATATTTGGGAGTTCAGTCGTCGAATGCAAAGCGT
AAAAAATATTAATAAGGTAAAAATTACAGCTACATAAATTACACAATTTAAACGGATCCCGGGT
ACCTTCTAGAATTCCGGAGCGGCCGCTGCAGATCTgatccTTTCCTGGGACCCGGCAAGAACCA
AAAACTCACTCTCTTCAAGGAAATCCGTAATGTTAAACCCGACACGATGAAGCTTGTCGTTGGA
TGGAAAGGAAAAGAGTTCTACAGGGAAACTTGGACCCGCTTCATGGAAGACAGCTTCCCCATTG
TTAACGACCAAGAAGTGATGGATGTTTTCCTTGTTGTCAACATGCGTCCCACTAGACCCAACCG
TTGTTACAAATTCCTGGCCCAACACGCTCTGCGTTGCGACCCCGACTATGTACCTCATGACGTG
ATTAGGATCGTCGAGCCTTCATGGGTGGGCAGCAACAACGAGTACCGCATCAGCCTGGCTAAGA
AGGGCGGCGGCTGCCCAATAATGAACCTTCACTCTGAGTACACCAACTCGTTCGAACAGTTCAT
CGATCGTGTCATCTGGGAGAACTTCTACAAGCCCATCGTTTACATCGGTACCGACTCTGCTGAA
GAGGAGGAAATTCTCCTTGAAGTTTCCCTGGTGTTCAAAGTAAAGGAGTTTGCACCAGACGCAC
CTCTGTTCACTGGTCCGGCGTATTAAAACACGATACATTGTTATTAGTACATTTATTAAGCGCT
AGATTCTGTGCGTTGTTGATTTACAGACAATTGTTGTACGTATTTTAATAATTCATTAAATTTA
TAATCTTTAGGGTGGTATGTTAGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCTGAATT
TAAATATTAAATCCTCAATAGATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGTTGTTT
TTCCGAACCGATGGCTGGACTATCTAATGGATTTTCGCTCAACGCCACAAAACTTGCCAAATCT
TGTAGCAGCAATCTAGCTTTGTCGATATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTCGACGT
CGTTCAAAATATTATGCGCTTTTGTATTTCTTTCATCACTGTCGTTAGTGTACAATTGACTCGA
CGTAAACACGTTAAATAAAGCTTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAGGCCGA
TTATCGTCGTCGTCCCAACCCTCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCATAGCCA
CACGACGCCTATTAATTGTGTCGGCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTTTTTGG
AATTATTTCTGATTGCGGGCGTTTTTGGGCGGGTTTCAATCTAACTGTGCCCGATTTTAATTCA
GACAACACGTTAGAAAGCGATGGTGCAGGCGGTGGTAACATTTCAGACGGCAAATCTACTAATG
GCGGCGGTGGTGGAGCTGATGATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGCGGCGG
AGGCGGAGGCGGAGGTGGTGGCGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTTTAGGC
AACACAGTCGGCACCTCAACTATTGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGGTCTGA
GACGAGTGCGATTTTTTTCGTTTCTAATAGCTTCCAACAATTGTTGTCTGTCGTCTAAAGGTGC
AGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGCGGGCGGCAATTCAGACATCGATGGTGGTGGT
GGTGGTGGAGGCGCTGGAATGTTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGGTATAA
TTTGTTCTGGTTTAGTTTGTTCGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGCTGCAC
AACGGAAGGTCGTCTGCTTCGAGGCAGCGCTTGGGGTGGTGGCAATTCAATATTATAATTGGAA
TACAAATCGTAAAAATCTGCTATAAGCATTGTAATTTCGCTATCGTTTACCGTGCCGATATTTA
ACAACCGCTCAATGTAAGCAATTGTATTGTAAAGAGATTGTCTCAAGCTCCGCACGCCGATAAC
AAGCCTTTTCATTTTTACTACAGCATTGTAGTGGCGAGACACTTCGCTGTCGTCGACGTACATG
TATGCTTTGTTGTCAAAAACGTCGTTGGCAAGCTTTAAAATATTTAAAAGAACATCTCTGTTCA
GCACCACTGTGTTGTCGTAAATGTTGTTTTTGATAATTTGCGCTTCCGCAGTATCGACACGTTC
AAAAAATTGATGCGCATCAATTTTGTTGTTCCTATTATTGAATAAATAAGATTGTACAGATTCA
TATCTACGATTCGTCATGGCCACCACAAATGCTACGCTGCAAACGCTGGTACAATTTTACGAAA
ACTGCAAAAACGTCAAAACTCGGTATAAAATAATCAACGGGCGCTTTGGCAAAATATCTATTTT
ATCGCACAAGCCCACTAGCAAATTGTATTTGCAGAAAACAATTTCGGCGCACAATTTTAACGCT
GACGAAATAAAAGTTCACCAGTTAATGAGCGACCACCCAAATTTTATAAAAATCTATTTTAATC
ACGGTTCCATCAACAACCAAGTGATCGTGATGGACTACATTGACTGTCCCGATTTATTTGAAAC
ACTACAAATTAAAGGCGAGCTTTCGTACCAACTTGTTAGCAATATTATTAGACAGCTGTGTGAA
GCGCTCAACGATTTGCACAAGCACAATTTCATACACAACGACATAAAACTCGAAAATGTCTTAT
ATTTCGAAGCACTTGATCGCGTGTATGTTTGCGATTACGGATTGTGCAAACACGAAAACTCACT
TAGCGTGCACGACGGCACGTTGGAGTATTTTAGTCCGGAAAAAATTCGACACACAACTATGCAC
GTTTCGTTTGACTGGTACGCGGCGTGTTAACATACAAGTTGCTAACCGGcggttcGTAATCATG
GTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGA
AGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCT
CACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGC
GGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCG
GTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAAT
CAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA
GGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC
TCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCT
CCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTC
GGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGC
TCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACT
ATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAG
GATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGC
TACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAG
TTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCA
GCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGAC
GCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCA
CCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTG
GTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCA
TCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCC
CCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCA
GCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT
AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCA
TTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCA
ACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT
CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATA
ATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTC
ATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACC
GCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCT
CAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTC
AGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAA
AAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAA
GCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACA
AATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATC
ATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATG
ACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGC
CGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAAC
TATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGAT
GCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGG
GCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGA
TTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCC