Vector Sequences

pAcAB4 DNA Sequence

Complete Sequence: 10230 bp
p10 promoter 4463 - 4558
pH promoter 4722 - 4810
p10 promoter 4852 -> 4947
pH promoter 5000 -> 5091
Amp(R) 8199->9059
ColE ori 9230 - 9818

AATTCTACTCGTAAAGCGAGTTGAAGGATCATATTTAGTTGCGTTTATGAGATAAGATTGAAAG
CACGTGTAAAATGTTTCCCGCGCGTTGGCACAACTATTTACAATGCGGCCAAGTTATAAAAGAT
TCTAATCTGATATGTTTTAAAACACCTTTGCGGCCCGAGTTGTTTGCGTACGTGACTAGCGAAG
AAGATGTGTGGACCGCAGAACAGATAGTAAAACAAAACCCTAGTATTGGAGCAATAATCGATTT
AACCAACACGTCTAAATATTATGATGGTGTGCATTTTTTGCGGGCGGGCCTGTTATACAAAAAA
ATTCAAGTACCTGGCCAGACTTTGCCGCCTGAAAGCATAGTTCAAGAATTTATTGACACGGTAA
AAGAATTTACAGAAAAGTGTCCCGGCATGTTGGTGGGCGTGCACTGCACACACGGTATTAATCG
CACCGGTTACATGGTGTGCAGATATTTAATGCACACCCTGGGTATTGCGCCGCAGGAAGCCATA
GATAGATTCGAAAAAGCCAGAGGTCACAAAATTGAAAGACAAAATTACGTTCAAGATTTATTAA
TTTAATTAATATTATTTGCATTCTTTAACAAATACTTTATCCTATTTTCAAATTGTTGCGCTTC
TTCCAGCGAACCAAAACTATGCTTCGCTTGCTCCGTTTAGCTTGTAGCCGATCAGTGGCGTTGT
TCCAATCGACGGTAGGATTAGGCCGGATATTCTCCACCACAATGTTGGCAACGTTGATGTTACG
TTTATGCTTTTGGTTTTCCACGTACGTCTTTTGGCCGGTAATAGCCGTAAACGTAGTGCCGTCG
CGCGTCACGCACAACACCGGATGTTTGCGCTTGTCCGCGGGGTATTGAACCGCGCGATCCGACA
AATCCACCACTTTGGCAACTAAATCGGTGACCTGCGCGTCTTTTTTCTGCATTATTTCGTCTTT
CTTTTGCATGGTTTCCTGGAAGCCGGTGTACATGCGGTTTAGATCAGTCATGACGCGCGTGACC
TGCAAATCTTTGGCCTCGATCTGCTTGTCCTTGATGGCAACGATGCGTTCAATAAACTCTTGTT
TTTTAACAAGTTCCTCGGTTTTTTGCGCCACCACCGCTTGCAGCGCGTTTGTGTGCTCGGTGAA
TGTCGCAATCAGCTTAGTCACCAACTGTTTGCTCTCCTCCTCCCGTTGTTTGATCGCGGGATCG
TACTTGCCGGTGCAGAGCACTTGAGGAATTACTTCTTCTAAAAGCCATTCTTGTAATTCTATGG
CGTAAGGCAATTTGGACTTCATAATCAGCTGAATCACGCCGGATTTAGTAATGAGCACTGTATG
CGGCTGCAAATACAGCGGGTCGCCCCTTTTCACGACGCTGTTAGAGGTAGGGCCCCCATTTTGG
ATGGTCTGCTCAAATAACGATTTGTATTTATTGTCTACATGAACACGTATAGCTTTATCACAAA
CTGTATATTTTAAACTGTTAGCGACGTCCTTGGCCACGAACCGGACCTGTTGGTCGCGCTCTAG
CACGTACCGCAGGTTGAACGTATCTTCTCCAAATTTAAATTCTCCAATTTTAACGCGAGCCATT
TTGATACACGTGTGTCGATTTTGCAACAACTATTGTTTTTTAACGCAAACTAAACTTATTGTGG
TAAGCAATAATTAAATATGGGGGAACATGCGCCGCTACAACACTCGTCGTTATGAACGCAGACG
GCGCCGGTCTCGGCGCAAGCGGCTAAAACGTGTTGCGCGTTCAACGCGGCAAACATCGCAAAAG
CCAATAGTACAGTTTTGATTTGCATATTAACGGCGATTTTTTAAATTATCTTATTTAATAAATA
GTTATGACGCCTACAACTCCCCGCCCGCGTTGACTCGCTGCACCTCGAGCAGTTCGTTGACGCC
TTCCTCCGTGTGGCCGAACACGTCGAGCGGGTGGTCGATGACCAGCGGCGTGCCGCACGCGACG
CACAAGTATCTGTACACCGAATGATCGTCGGGCGAAGGCACGTCGGCCTCCAAGTGGCAATATT
GGCAAATTCGAAAATATATACAGTTGGGTTGTTTGCGCATATCTATCGTGGCGTTGGGCATGTA
CGTCCGAACGTTGATTTGCATGCAAGCCGAAATTAAATCATTGCGATTAGTGCGATTAAAACGT
TGTACATCCTCGCTTTTAATCATGCCGTCGATTAAATCGCGCAATCGAGTCAAGTGATCAAAGT
GTGGAATAATGTTTTCTTTGTATTCCCGAGTCAAGCGCAGCGCGTATTTTAACAAACTAGCCAT
CTTGTAAGTTAGTTTCATTTAATGCAACTTTATCCAATAATATATTATGTATCGCACGTCAAGA
ATTAACAATGCGCCCGTTGTCGCATCTCAACACGACTATGATAGAGATCAAATAAAGCGCGAAT
TAAATAGCTTGCGACGCAACGTGCACGATCTGTGCACGCGTTCCGGCACGAGCTTTGATTGTAA
TAAGTTTTTACGAAGCGATGACATGACCCCCGTAGTGACAACGATCACGCCCAAAAGAACTGCC
GACTACAAAATTACCGAGTATGTCGGTGACGTTAAAACTATTAAGCCATCCAATCGACCGTTAG
TCGAATCAGGACCGCTGGTGCGAGAAGCCGCGAAGTATGGCGAATGCATCGTATAACGTGTGGA
GTCCGCTCATTAGAGCGTCATGTTTAGACAAGAAAGCTACATATTTAATTGATCCCGATGATTT
TATTGATAAATTGACCCTAACTCCATACACGGTATTCTACAATGGCGGGGTTTTGGTCAAAATT
TCCGGACTGCGATTGTACATGCTGTTAACGGCTCCGCCCACTATTAATGAAATTAAAAATTCCA
ATTTTAAAAAACGCAGCAAGAGAAACATTTGTATGAAAGAATGCGTAGAAGGAAAGAAAAATGT
CGTCGACATGCTGAACAACAAGATTAATATGCCTCCGTGTATAAAAAAAATATTGAACGATTTG
AAAGAAAACAATGTACCGCGCGGCGGTATGTACAGGAAGAGGTTTATACTAAACTGTTACATTG
CAAACGTGGTTTCGTGTGCCAAGTGTGAAAACCGATGTTTAATCAAGGCTCTGACGCATTTCTA
CAACCACGACTCCAAGTGTGTGGGTGAAGTCATGCATCTTTTAATCAAATCCCAAGATGTGTAT
AAACCACCAAACTGCCAAAAAATGAAAACTGTCGACAAGCTCTGTCCGTTTGCTGGCAACTGCA
AGGGTCTCAATCCTATTTGTAATTATTGAATAATAAAACAATTATAAATGCTAAATTTGTTTTT
TATTAACGATACAAACCAAACGCAACAAGAACATTTGTAGTATTATCTATAATTGAAAACGCGT
AGTTATAATCGCTGAGGTAATATTTAAAATCATTTTCAAATGATTCACAGTTAATTTGCGACAA
TATAATTTTATTTTCACATAAACTAGACGCCTTGTCGTCTTCTTCTTCGTATTCCTTCTCTTTT
TCATTTTTCTCCTCATAAAAATTAACATAGTTATTATCGTATCCATATATGTATCTATCGTATA
GAGTAAATTTTTTGTTGTCATAAATATATATGTCTTTTTTAATGGGGTGTATAGTACCGCTGCG
CATAGTTTTTCTGTAATTTACAACAGTGCTATTTTCTGGTAGTTCTTCGGAGTGTGTTGCTTTA
ATTATTAAATTTATATAATCAATGAATTTGGGATCGTCGGTTTTGTACAATATGTTGCCGGCAT
AGTACGCAGCTTCTTCTAGTTCAATTACACCATTTTTTAGCAGCACCGGATTAACATAACTTTC
CAAAATGTTGTACGAACCGTTAAACAAAAACAGTTCACCTCCCTTTTCTATACTATTGTCTGCG
AGCAGTTGTTTGTTGTTAAAAATAACAGCCATTGTAATGAGACGCACAAACTAATATCACAAAC
TGGAAATGTCTATCAATATATAGTTGCTGATGATCCAGCATGATAAGATACATTGATGAGTTTG
GACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGC
TTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTCCGAGTTTGTCAGAAAGCAGACCAAAC
AGCGGTTGGAATAATAGCGAGAACAGAGAAATAGCGGCAAAAATAATACCCGTATCACTTTTGC
TGATATGGTTGATGTCATGTAGCCAAATCGGGAAAAACGGGAAGTAGGCTCCCATGATAAAAAA
GTAAAAGAAAAAGAATAAACCGAACATCCAAAAGTTTGTGTTTTTTAAATAGTACATAATGGAT
TTCCTTACGCGAAATACGGGCAGACATGGCCTGCCCGGTTATTATTATTTTTGACACCAGACCA
ACTGGTAATGGTAGCGACCGGCGCTCAGCTGGAATTCAGATCTGTGATTGTAAATAAAATGTAA
TTTACAGTATAGTATTTTAATTAATATACAAATGATTTGATAATAATTCTTATTTAACTATAAT
ATATTGTGTTGGGTTGAATTAAAGGTCCCGGCATCCTCAAATGCATAATTTCATAGTCCCCCTT
GTTGTAAGTGATGCGTATTTCTGAATCTTTGTAAAATAGCACACAAGACTCCAACGCGTTTGGC
GTTTTATTTTCTTGCTCGACTCTAGTTTATTAGGCCTCTAGAGATCCGTATTTATAGGTTTTTT
TATTACAAAACTGTTACGAAAACAGTAAAATACTTATTTATTTGCGAGATGGTTATCATTTTAA
TTATCTCCATGATCCAATAACCTAGAATAAAGGGCCCGACCTTTAATTCAACCCAACACAATAT
ATTATAGTTAAATAAGAATTATTATCAAATCATTTGTATATTAATTAAAATACTATACTGTAAA
TTACATTTTATTTACAATCACAGATCCCCGGGACTAGTAATAAAACCTAGAGGATCGATCCCCC
GGATCTGATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTT
TTCGTAACAGTTTTGTAATAAAAAAACCTATAAATACGGATCCGGTTATTAGTACATTTATTAA
GCGCTAGATTCTGTGCGTTGTTGATTTACAGACAATTGTTGTACGTATTTTAATAATTCATTAA
ATTTATAATCTTTAGGGTGGTATGTTAGAGCGAAAATCAAATGATTTTCAGCGTCTTTATATCT
GAATTTAAATATTAAATCCTCAATAGATTTGTAAAATAGGTTTCGATTAGTTTCAAACAAGGGT
TGTTTTTCCGAACCGATGGCTGGACTATCTAATGGATTTTCGCTCAACGCCACAAAACTTGCCA
AATCTTGTAGCAGCAATCTAGCTTTGTCGATATTCGTTTGTGTTTTGTTTTGTAATAAAGGTTC
GACGTCGTTCAAAATATTATGCGCTTTTGTATTTCTTTCATCACTGTCGTTAGTGTACAATTGA
CTCGACGTAAACACGTTAAATAAAGCTTGGACATATTTAACATCGGGCGTGTTAGCTTTATTAG
GCCGATTATCGTCGTCGTCCCAACCCTCGTCGTTAGAAGTTGCTTCCGAAGACGATTTTGCCAT
AGCCACACGACGCCTATTAATTGTGTCGGCTAACACGTCCGCGATCAAATTTGTAGTTGAGCTT
TTTGGAATTATTTCTGATTGCGGGCGTTTTTGGGCGGGTTTCAATCTAACTGTGCCCGATTTTA
ATTCAGACAACACGTTAGAAAGCGATGGTGCAGGCGGTGGTAACATTTCAGACGGCAAATCTAC
TAATGGCGGCGGTGGTGGAGCTGATGATAAATCTACCATCGGTGGAGGCGCAGGCGGGGCTGGC
GGCGGAGGCGGAGGCGGAGGTGGTGGCGGTGATGCAGACGGCGGTTTAGGCTCAAATGTCTCTT
TAGGCAACACAGTCGGCACCTCAACTATTGTACTGGTTTCGGGCGCCGTTTTTGGTTTGACCGG
TCTGAGACGAGTGCGATTTTTTTCGTTTCTAATAGCTTCCAACAATTGTTGTCTGTCGTCTAAA
GGTGCAGCGGGTTGAGGTTCCGTCGGCATTGGTGGAGCGGGCGGCAATTCAGACATCGATGGTG
GTGGTGGTGGTGGAGGCGCTGGAATGTTAGGCACGGGAGAAGGTGGTGGCGGCGGTGCCGCCGG
TATAATTTGTTCTGGTTTAGTTTGTTCGCGCACGATTGTGGGCACCGGCGCAGGCGCCGCTGGC
TGCACAACGGAAGGTCGTCTGCTTCGAGGCAGCGCTTGGGGTGGTGGCAATTCAATATTATAAT
TGGAATACAAATCGTAAAAATCTGCTATAAGCATTGTAATTTCGCTATCGTTTACCGTGCCGAT
ATTTAACAACCGCTCAATGTAAGCAATTGTATTGTAAAGAGATTGTCTCAAGCTCGGATCGATC
CCGCACGCCGATAACAAGCCTTTTCATTTTTACTACAGCATTGTAGTGGCGAGACACTTCGCTG
TCGTCGACGTACATGTATGCTTTGTTGTCAAAAACGTCGTTGGCAAGCTTTAAAATATTTAAAA
GAACATCTCTGTTCAGCACCACTGTGTTGTCGTAAATGTTGTTTTTGATAATTTGCGCTTCCGC
AGTATCGACACGTTCAAAAAATTGATGCGCATCAATTTTGTTGTTCCTATTATTGAATAAATAA
GATTGTACAGATTCATATCTACGATTCGTCATGGCCACCACAAATGCTACGCTGCAAACGCTGG
TACAATTTTACGAAAACTGCAAAAACGTCAAAACTCGGTATAAAATAATCAACGGGCGCTTTGG
CAAAATATCTATTTTATCGCACAAGCCCACTAGCAAATTGTATTTGCAGAAAACAATTTCGGCG
CACAATTTTAACGCTGACGAAATAAAAGTTCACCAGTTAATGAGCGACCACCCAAATTTTATAA
AAATCTATTTTAATCACGGTTCCATCAACAACCAAGTGATCGTGATGGACTACATTGACTGTCC
CGATTTATTTGAAACACTACAAATTAAAGGCGAGCTTTCGTACCAACTTGTTAGCAATATTATT
AGACAGCTGTGTGAAGCGCTCAACGATTTGCACAAGCACAATTTCATACACAACGACATAAAAC
TCGAAAATGTCTTATATTTCGAAGCACTTGATCGCGTGTATGTTTGCGATTACGGATTGTGCAA
ACACGAAAACTCACTTAGCGTGCACGACGGCACGTTGGAGTATTTTAGTCCGGAAAAAATTCGA
CACACAACTATGCACGTTTCGTTTGACTGGTACGCGGCGTGTTAACATACAAGTTGCTAACCGG
CGGCCGACACCCATTTGAAAAAAGCGAAGACGAAATGTTGGACTTGAATAGCATGAAGCGTCGT
CAGCAATACAATGACATTGGCGTTTTAAAACACGTTCGTAACGTTAACGCTCGTGACTTTGTGT
ACTGCCTAACAAGATACAACATAGATTGTAGACTCACAAATTACAAACAAATTATAAAACATGA
GTTTTTGTCGTAAAAATGCCACTTGTTTTACGAGTAGAATTCCCAGCTTGGCACTGGCCGTCGT
TTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCC
CCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCA
GCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACA
CCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACAC
CCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAG
CTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGGA
CGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGA
CGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACA
TTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGG
AAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTC
CTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACG
AGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAA
CGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACG
CCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACC
AGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACC
ATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCG
CTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGA
AGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAA
CTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGG
ATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATC
TGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCC
CGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCG
CTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACT
TTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAAT
CTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGA
TCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACC
ACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACT
GGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACT
TCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGC
CAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAG
CGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAAC
TGAGATACCTACAGCGTGAGCATTGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAG
GTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCC
TGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCT
CGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTT
TTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATT
ACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGA
GCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTA
ATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTG
AGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTG
GAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACG