Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD197 (CCR7)

BD™ AbSeq Oligo Rat Anti-Mouse CD197 (CCR7)

Clone 4B12

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
C-C chemokine receptor type 7; CD197; Ccr7; Cmkbr7; EBI1; Ebi1h
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGCGGGTATGGTCGTTAGGATGCTTAGTATTCGG
AMM2061
Mouse CCR7 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940165 Rev. 2
Antibody Details
Down Arrow Up Arrow
4B12

The monoclonal antibody 4B12/CCR7 reacts with the mouse C-C chemokine receptor type 7 (CCR7). CCR7 is also known as CD197 (previously known as EBI1, Ebi1h and CMKBR7) and plays a central role in mediating homeostatic B and T lymphocyte trafficking to and within secondary lymphoid tissues. CD197 is a seven-transmembrane, G-protein-coupled, 43 kDa glycoprotein receptor that is specific for the CC chemokines, MIP3ß/Exodus-3/ELC/CKb11/Scya19/CCL19 and 6Ckine/Exodus-2/SLC/TCA4/CKb9/Scya21/CCL21. The mouse Ccr7 gene is located on chromosome 11. CD197 (CCR7) is differentially expressed by subsets of thymocytes. Positive CD197 expression appears to be involved in the cortex-to-medulla migration of positively-selected thymocytes wherein they complete functional maturation including the establishment of central tolerance. It is most highly expressed by some mature medullary single-positive thymocytes. CD197 is also expressed by subsets of mature peripheral CD4+ and CD8+ T lymphocytes including naïve and regulatory T cells and central memory T cells. In addition, it is differentially expressed by subsets of B lymphocytes, dendritic cells, and Langerhans cells. CD197 serves as a homing receptor that helps guide these various cell types to and within lymphoid tissues. In this way, CCR7 supports protective immunity while safeguarding self tolerance. Reportedly, the 4B12/CCR7 antibody is not agonistic, is not blocked by CCL21 nor by physiologic levels of CCL19, nor does the antibody block the binding of CCL21 to CCR7. The immunogen used to generate the 4B12 hybridoma was a mouse CCR7-transfected rat cell line.

940165 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940165 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Britschgi MR, Link A, Lissandrin TK, Luther SA. Dynamic modulation of CCR7 expression and function on naive T lymphocytes in vivo. J Immunol. 2008; 181(11):7681-7688. (Clone-specific: Flow cytometry). View Reference
  2. Forster R, Davalos-Misslitz AC, Rot A. CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol. 2008; 8(5):362-371. (Biology). View Reference
  3. Kurobe, H., Liu, et al. CCR7-dependent cortex-to-medulla migration of positively selected thymocytes is essential for establishing central tolerance. Immunity. 2006; 24(2):165-177. (Biology). View Reference
  4. Ohl L, Mohaupt M, Czeloth N, et al. CCR7 governs skin dendritic cell migration under inflammatory and steady-state conditions. Immunity. 2004; 21(2):279-288. (Clone-specific: Flow cytometry, Immunofluorescence, Immunoprecipitation, Neutralization). View Reference
  5. Schweickart VL, Raport CJ, Godiska R, et al. Cloning of human and mouse EBI1, a lymphoid-specific G-protein-coupled receptor encoded on human chromosome 17q12-q21.2. Genomics. 1994; 23(3):643-650. (Biology). View Reference
940165 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.