Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD200

BD™ AbSeq Oligo Rat Anti-Mouse CD200

Clone OX-90 (also known as OX90)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd200; OX2; OX-2; OX2G; MRC OX-2 antigen; Mox2
17470
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGTAAATGGAGTAAGCACGTAGTATGGCGGCAGTT
AMM2104
Soluble fusion protein of the extracellular region of mouse OX-2 antigen w/domains 3 & 4 of rat CD4
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940208 Rev. 2
Antibody Details
Down Arrow Up Arrow
OX-90

The OX-90 monoclonal antibody specifically recognizes CD200 (OX-2 antigen), a type-1 transmembrane glycoprotein containing two extracellular Ig-like domains. CD200 is expressed on thymocytes, neurons, B lymphocytes, splenic follicular dendritic cells and endothelium, and subsets of T lymphocytes and dendritic cells; but not on NK cells, granulocytes, monocytes, or macrophages. CD200 Receptor (CD200R; OX2R) expression is restricted to myeloid cells, and it appears that its engagement with CD200 results in inhibition and/or down-regulation of myeloid cell activity.

940208 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940208 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Gorczynski L, Chen Z, Hu J, et al. Evidence that an OX-2-positive cell can inhibit the stimulation of type 1 cytokine production by bone marrow-derived B7-1 (and B7-2)-positive dendritic cells. J Immunol. 1999; 162(2):774-781. (Biology). View Reference
  3. Hoek RM, Ruuls SR, Murphy CA, et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200).. Science. 2000; 290(5497):1768-71. (Immunogen: ELISA, Flow cytometry, Immunohistochemistry). View Reference
  4. Preston S, Wright GJ, Starr K, Barclay AN, Brown MH. The leukocyte/neuron cell surface antigen OX2 binds to a ligand on macrophages. Eur J Immunol. 1997; 27(8):1911-1918. (Biology). View Reference
940208 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.