Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD41

BD™ AbSeq Oligo Rat Anti-Mouse CD41

Clone MWReg30

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Itga2b; Integrin alpha 2b; Integrin alpha-IIb; Integrin α IIb; GpIIb
16399
2 µl
Rat IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGATGTGCTAAGTTGCGTGGTCGAGTGAGAATTGT
AMM2051
Mouse Platelets
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940155 Rev. 2
Antibody Details
Down Arrow Up Arrow
MWReg30

The MWReg30 monoclonal antibody specifically binds to CD41, which is also known as glycoprotein IIb (gpIIb, GP IIb), Integrin α IIb chain, or Integrin alpha 2b. CD41 is a transmembrane glycoprotein that is encoded by Itga2b. CD41 associates with Integrin β3 chain (gpIIIa or CD61) to form the gpIIb/IIIa (CD41/CD61) complex. CD41/CD61 is expressed on platelets, megakaryocytes, and early hematopoietic progenitors. The integrin complex binds to fibrinogen, fibronectin, vitronectin, von Willebrand factor, and thrombospondin. It is important for platelet adhesion and aggregation, and it may play a role in osteolytic tumor metastasis.

940155 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940155 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Bakewell SJ, Nestor P, Prasad S, et al. Platelet and osteoclast beta3 integrins are critical for bone metastasis. Proc Natl Acad Sci U S A. 2003; 100(24):14205-14210. (Biology). View Reference
  2. Ferkowicz MJ, Starr M, Xie X, et al. CD41 expression defines the onset of primitive and definitive hematopoiesis in the murine embryo. Development. 2003; 130(18):4393-4403. (Biology). View Reference
  3. Kieffer N, Phillips DR. Platelet membrane glycoproteins: functions in cellular interactions. Annu Rev Cell Biol. 1990; 6:329-357. (Clone-specific: Immunohistochemistry). View Reference
  4. Nieswandt B, Echtenacher B, Wachs FP, et al. Acute systemic reaction and lung alterations induced by an antiplatelet integrin gpIIb/IIIa antibody in mice. Blood. 1999; 94(2):684-693. (Immunogen: Activation, Flow cytometry, Immunohistochemistry, Immunoprecipitation, Inhibition, In vivo exacerbation). View Reference
  5. Phillips DR, Charo IF, Scarborough RM. GPIIb-IIIa: the responsive integrin. Cell. 1991; 65(3):359-362. (Biology). View Reference
940155 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.