Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse TCR ß Chain

BD™ AbSeq Oligo Hamster Anti-Mouse TCR ß Chain

Clone H57-597

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Tcrb; TCRbeta; TCRβ, T cell receptor beta chain
21577
2 µl
Armenian Hamster IgG2, λ1
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAGGTATTAGGAAGATTAGGCCGTTATGATTGGAGC
AMM2021
TCR affinity-purified from mouse T-cell hybridoma DO-11.10
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940125 Rev. 2
Antibody Details
Down Arrow Up Arrow
H57-597

The H57-597 antibody reacts with a common epitope of the β chain of the T-cell Receptor (TCR) complex on αβ TCR-expressing thymocytes, peripheral T lymphocytes, NK1.1+ thymocytes, and NK-T cells of all mouse strains tested. It does not react with γδ TCR-bearing T cells. In the fetal and adult thymus, the TCR β-chain may form homodimers or pair with the pre-TCR α-chain on the surface of immature thymocytes before TCR α-chain expression. Plate-bound or soluble H57-597 antibody activates αβ TCR-bearing T cells, and plate-bound mAb can induce apoptotic death.

940125 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940125 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (3)

  1. Gascoigne NR. Transport and secretion of truncated T cell receptor beta-chain occurs in the absence of association with CD3. J Biol Chem. 1990; 265(16):9296-9301. (Clone-specific: Immunofluorescence, Immunoprecipitation). View Reference
  2. Kruisbeek AM, Shevach EM. Proliferative assays for T cell function. Curr Protoc Immunol. 2004; 3:3.12.1-3.12.14. (Clone-specific: Activation, Functional assay, Stimulation). View Reference
  3. Kubo RT, Born W, Kappler JW, Marrack P, Pigeon M. Characterization of a monoclonal antibody which detects all murine alpha beta T cell receptors. J Immunol. 1989; 142(8):2736-2742. (Immunogen: Activation, Flow cytometry, Functional assay, Stimulation). View Reference
940125 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.