Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD11c

BD™ AbSeq Oligo Hamster Anti-Mouse CD11c

Clone HL3

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd11c; Itgax; Integrin alpha-X; Integrin αX; Cr4; Complement receptor 4
16411
2 µl
Armenian Hamster IgG1, λ2
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTGGGCGTAAAGGGTAAGGCGGTATATGGACTGTG
AMM2008
C57BL/6 Mouse Intestinal Intraepithelial Lymphocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940112 Rev. 2
Antibody Details
Down Arrow Up Arrow
HL3

The HL3 monoclonal antibody specifically binds to the integrin αx chain of gp150, 95 (CD11c/CD18). CD11c is expressed on dendritic cells, CD4- CD8+ intestinal intraepithelial lymphocytes (IEL) and some NK cells. It is upregulated on IEL and lymph-node T cells following in vivo activation. Cells of the monocyte/macrophage lineage have been reported to express low levels of CD11c. CD11c plays a role in binding of iC3b.

940112 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940112 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (7)

  1. Burt BM, Plitas G, Stableford JA, et al. CD11c identifies a subset of murine liver natural killer cells that responds to adenoviral hepatitis. J Leukoc Biol. 2008; 84(4):1039-1046. (Clone-specific: Flow cytometry). View Reference
  2. Fagarasan S, Muramatsu M, Suzuki K, Nagaoka H, Hiai H, Honjo T. Critical roles of activation-induced cytidine deaminase in the homeostasis of gut flora. Science. 2002; 298(5597):1424-1427. (Clone-specific: Immunofluorescence). View Reference
  3. Huleatt JW, Lefrançois L. Antigen-driven induction of CD11c on intestinal intraepithelial lymphocytes and CD8+ T cells in vivo.. J Immunol. 1995; 154(11):5684-93. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  4. Larson RS, Springer TA. Structure and function of leukocyte integrins. Immunol Rev. 1990; 114:181-217. (Biology). View Reference
  5. Maraskovsky E, Brasel K, Teepe M, et al. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J Exp Med. 1996; 184(5):1953-1962. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  6. Metlay JP, Witmer-Pack MD, Agger R, Crowley MT, Lawless D, Steinman RM. The distinct leukocyte integrins of mouse spleen dendritic cells as identified with new hamster monoclonal antibodies. J Exp Med. 1990; 171(5):1753-1771. (Biology). View Reference
  7. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997; 159(5):2222-2231. (Clone-specific: Immunohistochemistry). View Reference
View All (7) View Less
940112 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.